Have an account?
Skip to Content
Build your own quiz
Suggestions for you
26 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhat are the 3 parts of a nucleotide in Model 1?Deoxyribose sugar, phosphatePhosphate, nitrogen containing basedeoxyribose sugar, phosphate, nitrogen containing basePhosphate, sugar
- 2. Multiple ChoiceWhat kind of sugar is found in Model 1?RiboseDeoxyribose
- 3. Multiple ChoiceName all of the following nitrogen bases in Model 1Adenine and cytosinePyrimidinesAdenine, Thymine, GuanineAdenine, Thymine, Guanine, Cytosine
- 4. Multiple ChoiceWhat part (s) of the nucleotides make up the rungs or steps of the DNA "ladder"?sugarnitrogenous basesphosphatesugar and nitrogenous bases
- 5. Multiple Choice
What parts of the nucleotide make up the sides or backbone of the DNA "ladder"?
Phosphate and sugar
Sugar
Phosphate
Nitrogenous base
- 6. Multiple ChoiceLook at Model 1. Are the 2 strands running parallel (the ends of the strands match) or antiparallel (the ends of the strands are opposites)?ParallelAntiparallel
- 7. Multiple ChoiceWhen one nucleotide contains adenine, what type of base is the adenine attached to on the opposite nucleotide strand?AdenineGuanineCytosineThymine
- 8. Multiple Choice
When one nucleotide contains cytosine, what type of base is the cytosine attached to on the opposite nucleotide strand?
Guanine
Adenine
Thymine
Cytosine
- 9. Multiple ChoiceThe strands of DNA are held together by hydrogen bonds between the bases. How many bonds connect adenine and thymine? Use Model 1.1234
- 10. Multiple ChoiceThe strands of DNA are held together by hydrogen bonds between the bases. How many bonds connect cytosine and guanine? Use model 11234
- 11. Multiple ChoiceWhat are the complementary bases on the strand: ATCCAG ?ATCCAGCGTTCTTAGGTCTAGGAG
- 12. Multiple ChoiceWhich of the following best describe's DNA structure?Row of nucleotidesladder that is twistedflat ladder
- 13. Multiple ChoiceExamine Model 2. What has to happen FIRST during DNA replication?Hydrogen bonds between nucleotides formHydrogen bonds between nucleotides breakStrands of DNA separateFree nucleotides are attracted to exposed bases on loose strands
- 14. Multiple Choice
Looking at Model 2, what is the role of helicase?
To lay down nucleotides
To keep the DNA strands open
To break open or unwind and separate the DNA strands
- 15. Multiple ChoiceT/ F : Replication is known as semi-conservative because half the original molecule is kept and the other half is new.TrueFalse
- 16. Multiple ChoiceUsing the Table on page 4, what percentage of Adenine does salmon have?21222729
- 17. Multiple ChoiceUsing the Table on page 4, what percentage of cytosine does yeast have?31272919
- 18. Multiple ChoiceUsing the Table on Page 4, humans have the same base pair percentages as...CowsSalmonWheatYeast
- 19. Multiple ChoiceWhere does DNA replication occur?CytoplasmCell membraneNucleus
- 20. Multiple ChoiceWhen does DNA replication occur?During mitosisDuring meiosisDuring interphase
- 21. Multiple Choice
DNA and RNA are examples of ....
Enzymes
Carbohydrates
Proteins
Nucleic acids or polynucleotides
- 22. Multiple Choice
True/False: Deoxyribose is found in RNA, Ribose is found in DNA.
True
False
- 23. Multiple Choice
Which animal has the best hearing?
Moth
Bat
Dog
Owl
Cat
- 24. Multiple Choice
Which animal sleeps the most?
Sloth
Koala
Armadillo
Possum
Lemur
- 25. Multiple Choice
Which animal lays the MOST eggs?
Ostrich
Mallard Duck
Dove
Grey Partridge
- 26. Multiple Choice
True/ False: Male seahorses give birth to the babies.
True
False
- Answer choicesTagsAnswer choicesTags