Have an account?
Skip to Content
Build your own quiz
12 questions
Show Answers
See Preview
- 1. Multiple Choice
Which of the following is a MONOMER:Nucleic AcidNucleotidePolysaccharidePhospholipid - 2. Multiple ChoiceWhich of the following elements does a Nucleic Acid have that a Carbohydrate and Lipid do not?CarbonOxygenHydrogenNitrogen
- 3. Multiple ChoiceFrom the nucleotide on the right, which part is labeled 2?SugarPhosphateNitrogenous BasePhosphorous
- 4. Multiple ChoiceWhat pentose sugar does DNA use?RiboseSucroseAmyloseDeoxyribose
- 5. Multiple ChoiceWhich of the following is a purine?CytosineThymineAdenine
- 6. Multiple ChoiceGuanine is complementary to what other nitrogenous base?CytosineAdenineThymineUracil
- 7. Multiple ChoiceIf a cell has 20% Adenine in it, what % of Cytosine must it have?10%20%30%80%
- 8. Multiple ChoiceComplementary Bases are held together by what type of bond?CovalentHydrogenIonicMettalic
- 9. Multiple ChoiceIf one series of bases reads: TTGACTAGG, then the complementary set of bases would read:TTGACTAGGAACTGATCCAATCGAACTTAAGTCATCC
- 10. Multiple ChoiceWhen coiled together, DNA looks like a:Single HelixDouble HelixTriple HelixBroken Ladder
- 11. Multiple ChoiceThe backbone of DNA is made up of _______ & ________ units.sugar & basesugar & phosphatebase & phosphatephosphate & phosphate
- 12. Multiple ChoiceWhich part of the nucleotide is negative?The sugarThe baseThe phosphate
- Answer choicesTagsAnswer choicesTags