Have an account?
Skip to Content
Build your own quiz
15 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhich does NOT belong to DNA?PhosphateRiboseATCGDouble Strand
- 2. Multiple ChoiceWhich does NOT belong to RNA?RiboseSingle StandATCGPhosphate
- 3. Multiple ChoiceWhich is the correct complimentary strand to- ATTACAATTACATAATCTTAATGTTUUTGT
- 4. Multiple ChoiceDNA to DNA is called-TranscriptionTranslationReplicationDuplication
- 5. Multiple ChoiceA unit of DNA is called a(n)-Base PairNucleotideStrandGene
- 6. Multiple ChoiceWhat does NOT exist in DNA?AdenineGuanineUracilThymine
- 7. Multiple ChoiceTrue or False. DNA makes RNA makes PROTEINS makes TRAITSFalseTrue
- 8. Multiple ChoiceThis cannot leave the nucleusDNARNABoth
- 9. Multiple ChoiceWhich of the following complementary base pairs are correct?A - TA - GT - CG - U
- 10. Multiple ChoiceThe bonds that hold the two strands of DNA together come from...the attraction of phosphate groupsstrong bonds between bases and sugarscarbon to carbon bonds in the sugarweak hydrogen bonds between the bases
- 11. Multiple ChoiceWhat does a nucleotide consist of?Base, Phosphate, HydrogenPhosphate, Sugar, BaseHydrogen Bond, Sugar, PhosphateA drummer, guitar, bass, and singer
- 12. Multiple ChoiceWhat "unzips" the DNA to start replication?DNA PolymeraseDNA JustincaseDNA HelicaseDNA Briefcase
- 13. Multiple ChoiceIf the percentage of DNA is made of 30% Thymine, what is the correct percentage of Guanine?30152060
- 14. Multiple Choice
Name this structuredouble helixnucelotidetwisted ladderhydrogen bond - 15. Multiple ChoiceWhat is the correct complimentary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC
- Answer choicesTagsAnswer choicesTags