Have an account?
Skip to Content
Build your own quiz
Suggestions for you
26 questions
Show Answers
See Preview
- 1. Multiple Choice
Which of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil - 2. Multiple ChoiceWhich of the following units are repeatedly joined together to form a strand of DNA? (This is the MONOMER of DNA.)amino acidsnucleotidesfatty acidspolysaccharides
- 3. Multiple ChoiceAdenine bonds with ______________.GuanineThymineCytosineAdenine
- 4. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 5. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 6. Multiple ChoiceName this structuredouble helixnucelotidetwisted ladderhydrogen bond
- 7. Multiple ChoiceWhat are the 4 nitrogen bases?adenine, thymine, cytoplasm, and guanineadenine, thymine cytosine, and guanineadenine, thymine, cytosine, and gylceroladenine, thymine, cytosine, and glucose
- 8. Multiple ChoiceWhich 2 molecules forms the sides (backbone) of the DNA ladder?deoxyribose and adeninedeoxyribose and a hydrogen bondsugar and the nucleusdeoxyribose (sugar) and phosphate
- 9. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuolechloroplastnucleus
- 10. Multiple ChoiceWhich shows the correct complementary base pairing for DNA?C-A, T-GA-G, C-TC-G, U-AT-A, G-C
- 11. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 12. Multiple ChoiceWhat is the correct complementary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC
- 13. Multiple Choice
The DNA is found in the nucleus of what type of organisms?
Bacteria
Eukaryotes
Prokaryotes
Viruses
- 14. Multiple ChoiceWhat determines the code, or information, of a DNA molecule?the shape (structure) of the nitrogen basesthe order (sequence) of the nitrogen basesthe color of the nitrogen basesthe frequency (number) of nitrogen bases
- 15. Multiple ChoiceDNA codes for...cholesterolproteinsfatty acidscarbohydrates
- 16. Multiple ChoiceDNA is a polymer made of monomers calledNucleotidesProteinsAmino AcidsLipids
- 17. Multiple Choicea change in the nucelotide-base sequence of a gene or DNA moleculenucleotideDNARNAmutation
- 18. Multiple ChoiceHas a deoxyribose sugarDNARNA
- 19. Multiple ChoiceThe sides of the double helixsugar phosphatenucleotidesnitrogen bases
- 20. Multiple ChoiceWhat does DNA stand for?Deoxyribonucleic acidDenitrogenous acidDeribonucleic acidDiribonucleic acid
- 21. Multiple ChoiceWhich 2 molecules form the sides (backbone) of the DNA ladder?deoxyribose sugar and adeninedeoxyribose sugar and a hydrogen bonddeoxyribose sugar and the nucleusdeoxyribose sugar and phosphate
- 22. Multiple ChoiceNitrogenous bases are joined by which type of bond?polar bondsionic bondscovalent bondshydrogen bonds
- 23. Multiple ChoiceA five-carbon sugar found in DNA.riboseguaninedeoxyribosehelicase
- 24. Multiple ChoiceIf one strand of DNA runs 5' to 3' the other strand runs5' to 3'3' to 5'5' to 5'3' to 3'
- 25. Multiple ChoiceWhat is the percentage of T?22%11%28%50%
- 26. Multiple ChoiceIf a species has 33% A what is the percentage of C?33%17%34%67%
- Answer choicesTagsAnswer choicesTags