Have an account?
Skip to Content
Build your own quiz
Suggestions for you
30 questions
Show Answers
See Preview
- 1. Multiple ChoiceA monomer of DNA is called a(n)MonosaccharideAmino AcidTriglycerideNucleotide
- 2. Multiple ChoiceWhich shows the correct complementary base pairing for DNA?C-A, T-GA-G, C-TC-G, U-AT-A, G-C
- 3. Multiple ChoiceWho was NOT awarded the Nobel Prize for their part in discovering the helical structure of DNA?Rosalind FranklinFrancis CrickJames WatsonMaurice Wilkins
- 4. Multiple Choice______ forms the backbone of DNA and ______ forms the inside.Sugar and Nitrogen bases / phosphatesNitrogen bases / sugar and phosphateSugar and phosphate / nitrogen basesPhosphate and nitrogen bases / Sugar
- 5. Multiple ChoiceWhat two parts of a nucleotide do not change throughout the structure of DNA?Five-Carbon Sugar and Nitrogen BasePhosphate Group and Nitrogen BaseFive-Carbon Sugar and Phosphate GroupAll components remain the same throughout the DNA structure?
- 6. Multiple Choice
Which of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil - 7. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 8. Multiple ChoiceAdenine bonds with ______________.GuanineThymineCytosineAdenine
- 9. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 10. Multiple ChoiceWhat are the 4 nitrogen bases?adenine, thymine, cytoplasm, and guanineadenine, thymine cytosine, and guanineadenine, thymine, cytosine, and gylceroladenine, thymine, cytosine, and glucose
- 11. Multiple ChoiceWhich 2 molecules form the sides (backbone) of the DNA ladder?deoxyribose and adeninedeoxyribose and a hydrogen bonddeoxyribose and the nucleusdeoxyribose and phosphate
- 12. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuolechloroplastnucleus
- 13. Multiple ChoiceNitrogenous bases are joined by which type of bond?polar bondsionic bondscovalent bondshydrogen bonds
- 14. Multiple ChoiceNucleotides are made up of a sugar, phosphate, and..?nitrogenous basenucleic acidcholesterolfatty acid
- 15. Multiple ChoiceA five-carbon sugar found in DNA.riboseguaninedeoxyribosehelicase
- 16. Multiple ChoiceIf base-pairing rules state that Adenine always pairs with Thymine, and Cytosine pairs with Guanine, what would be the complementary strand to ACGGT?ACGGTTGGCATGCCAACCGT
- 17. Multiple ChoiceAn enzyme that unwinds the double helix of DNA and separates the DNA strands in preparation for DNA replicationDNA polymeraseRNA polymerasenucleotidehelicase
- 18. Multiple ChoiceDNA is copied duringTranslationTranscriptionReproductionReplication
- 19. Multiple ChoiceDNA replication results in two DNA molecules,each one with two original strandseach one with two new strandseach one with one new strand and one original strandone with two new strands and the other with two original strands
- 20. Multiple ChoiceReplication is referred to as...conservativesemi-conservativequasi-conservativemostly liberal
- 21. Multiple ChoiceWhich sequence of DNA bases would pair with this partial strand
ATG TGA CAGATG TGA CAGTAC ACT GTCGTA AGT GACCAT TCA CTG - 22. Multiple ChoiceWhich of the following is not a nitrogen base in DNA?AdenineCytosineUracilThymine
- 23. Multiple ChoiceThe pairing of _____ in DNA is the key feature that allows DNA to be copied.nucleotidesnitrogen baseschromosomescodons
- 24. Multiple ChoiceHow did Rosalind Franklin's photo 51 affect the work of Watson and Crick?It was used to determine the physical structure of DNAIt was used to identify the four bases that make up DNAIt was used to determine the theory of independent assortmentIt was used to show DNA was the molecule of inheritance
- 25. Multiple ChoiceWhere does DNA replication take place?NucleusRibosomeCytoplasmGolgi Body
- 26. Multiple ChoiceThe bonds that hold the two strands of DNA together come from...the attraction of phosphate groupsstrong ionic bondsstrong covalent bondsweak hydrogen bonds between the bases
- 27. Multiple ChoiceWhat sugar is in DNA?deoxyriboseriboseoxyribosedeoxyose
- 28. Multiple ChoiceThe enzyme that adds new nucleotides in replication is calledprimaseDNA polymeraseRNA polymeraseligase
- 29. Multiple ChoiceWhich enzyme proofreads the DNA after replication to catch any mistakes?primaseproof-read-aseDNA polymerasehelicase
- 30. Multiple ChoiceCell division requires that genetic material be able to...store informationundergo replicationundergo rare genetic mutations
- Answer choicesTagsAnswer choicesTags