Have an account?
Skip to Content
Build your own quiz
Suggestions for you
10 questions
Show Answers
See Preview
- 1. Multiple Choice
How does RNA differ from DNA?RNA contains uracil and deoxyriboseRNA contains ribose and thymineRNA contains uracil and riboseRNA contains adenine and ribose - 2. Multiple ChoiceHow would the DNA sequence GCTATA be transcribed to mRNA?GCUAUACGATATCGAUAUGCUTUT
- 3. Multiple ChoiceThe process by which the genetic code of DNA is copied into a strand of RNA is calledtranslationtranscriptiontransformationreplication
- 4. Multiple Choice
What is the correct order to make a protein?
Protein, DNA, RNA
RNA, DNA, Protein
DNA, RNA, Protein
Protein, RNA, DNA
- 5. Multiple Choice
RNA has what base that is instead of thymine?
guanine
adenine
thymine
uracil
- 6. Multiple Choice
What enzyme does transcription use?
DNA polymerase
ligase
RNA polymerase
helicase
- 7. Multiple Choice
Which RNA carries the message?
mRNA
rRNA
tRNA
- 8. Multiple ChoiceWhat part of a nucleotide accounts for the genetic variation between individuals?phosphatenitrogenous basedeoxyribosesugar
- 9. Multiple ChoiceIf one strand of DNA has the sequence TTACCG, the sequence of the other strand of the same molecule will beAATGGCTTACCGAACGGCAATGGG
- 10. Multiple ChoiceWhere does transcription take place?nucleuscytoplasmribosome
- Answer choicesTagsAnswer choicesTags