Have an account?
Skip to Content
Build your own quiz
Suggestions for you
42 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhich sequence of DNA bases would pair with this partial strand
ATG TGA CAGATG TGA CAGTAC ACT GTCGTA AGT GACCAT TCA CTG - 2. Multiple Choice
Which of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil - 3. Multiple ChoiceWhich of the following units are repeatedly joined together to form a strand of DNA?amino acidsnucleotidesfatty acidspolysaccharides
- 4. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 5. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 6. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 7. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 8. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 9. Multiple ChoiceWhat determines the code, or information, of a DNA molecule?the shape (structure) of the nitrogen basesthe order (sequence) of the nitrogen basesthe color of the nitrogen basesthe frequency (number) of nitrogen bases
- 10. Multiple ChoiceWhich 2 molecules form the sides (backbone) of the DNA ladder?deoxyribose sugar and adeninedeoxyribose sugar and a hydrogen bonddeoxyribose sugar and the nucleusdeoxyribose sugar and phosphate
- 11. Multiple ChoiceWhat are the three components of a nucleotide?sugar, hydrogen, nitrogen basesugar, oxygen, nitrogen basesugar, phosphate, nitrogen basesugar, phosphate, protein
- 12. Multiple ChoiceA process in which DNA has the unique ability to make an exact copy of itself.ReplicationTranslationTranscription
- 13. Multiple ChoiceNitrogenous bases are joined by which type of bond?polar bondsionic bondscovalent bondshydrogen bonds
- 14. Multiple ChoiceThe following picture must beDNA because it's double strandedRNA because it's single strandedDNA because it's single strandedRNA because it's double stranded
- 15. Multiple ChoiceWhich two scientists are accredited with correctly deducing the double helix model of DNA?Watson and CrickWilkins and FranklinWilkins and CrickWatson and Franklin
- 16. Multiple ChoiceWhat does this picture represent?amino acidbase pairingnucleotidethe DNA molecule
- 17. Multiple ChoiceAdenine bonds with ______________.GuanineThymineCytosineAdenine
- 18. Multiple ChoiceWhat is the correct complimentary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC
- 19. Multiple ChoiceThe correct spelling of DNA is....deoxiribonucleic aciddeoxyribosenucleic aciddeoxyribonucleic aciddeoxyribonucliec acid
- 20. Multiple ChoiceWhich of the following statements is true?DNA is single-strandedRNA is single-strandedDNA contains uracilRNA contains deoxyribose
- 21. Multiple ChoiceWhich of the following statements is true?DNA is single-strandedRNA is single-strandedDNA contains uracilRNA contains deoxyribose
- 22. Multiple ChoiceRNA contains the sugarribosedeoxyriboseglucoselactose
- 23. Multiple ChoiceRNA contains the sugarribosedeoxyriboseglucoselactose
- 24. Multiple ChoiceWhat is the difference between DNA and RNA in terms of bases?RNA contains uracil in place of thymineRNA contains uracil in place of adenineRNA contains uracil in place of guanineRNA contains uracil in place of cytosine
- 25. Multiple ChoiceWhat is the template for mRNA?DNAtRNArRNAproteins
- 26. Multiple ChoiceHow many nucleotides make a codon?1236
- 27. Multiple ChoiceHow many nucleotides make a codon?1236
- 28. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 29. Multiple ChoiceWhich type of RNA makes up part of a ribosome.rRNAtRNAmRNAkRNA
- 30. Multiple ChoiceWhich RNA aides in protein synthesis by putting amino acids in order.rRNAmRNAtRNAidkRNA
- 31. Multiple ChoiceHow many amino acids make up all protein of the human body?10040201000
- 32. Multiple Choice
Where does translation occur?
Nucleus
Ribosome
Lysosomes
Cytoplasm
- 33. Multiple Choice
Where does transcription occur?
Cytoplasm
Cell Membrane
Nucleus
Ribosome
- 34. Multiple Choice
What are amino acids held together by?
Peptide Bonds
Proteins
RNA
DNA
- 35. Multiple Choice
What is Thymine replaced with in RNA?
Uracil
Guanine
Adenine
Cytosine
- 36. Multiple ChoiceWhat part of our cells holds our DNA?cytoplasmcell membranenucleusribosomes
- 37. Multiple ChoiceA segment of DNA that codes for a protein is called a...EnzymeMutationGeneComplimentary
- 38. Multiple ChoicemRNA is important, because it __________.Carries info from genes to ribosomesCarries amino acids to ribosomesHelps with RNA splicingMakes up ribosomes
- 39. Multiple ChoicemRNA is important, because it __________.Carries info from genes to ribosomesCarries amino acids to ribosomesHelps with RNA splicingMakes up ribosomes
- 40. Multiple Choice
Protein synthesis (Translation) is important because it __________.
Converts mRNA into a protein
Copies the genetic information in DNA
Produces RNA from DNA molecules
Recycles tRNA molecules for reuse
- 41. Multiple Choice
What is the term for a three nucleotide sequence that codes for an amino acid? For example: AUG
Nitrogen base
Codon
Anticodon
Phosphate group
- 42. Multiple Choice
Which of the following is correct?
Proteins are made of nucleotides
Nucleic acids are of amino acids
Proteins are made of amino acids
- Answer choicesTagsAnswer choicesTags