Have an account?
Skip to Content
Build your own quiz
Suggestions for you
29 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhat two parts of a nucleotide do not change throughout the structure of DNA?Five-Carbon Sugar and Nitrogen BasePhosphate Group and Nitrogen BaseFive-Carbon Sugar and Phosphate GroupAll components remain the same throughout the DNA structure?
- 2. Multiple ChoiceWhich shows the correct complementary base pairing for DNA?C-A, T-GA-G, C-TC-G, U-AT-A, G-C
- 3. Multiple ChoiceA monomer of DNA is called a(n)MonosaccharideAmino AcidTriglycerideNucleotide
- 4. Multiple Choice
Which of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil - 5. Multiple ChoiceWhich of the following units are repeatedly joined together to form a strand of DNA?amino acidsnucleotidesfatty acidspolysaccharides
- 6. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 7. Multiple ChoiceAdenine bonds with ______________.GuanineThymineCytosineAdenine
- 8. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 9. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 10. Multiple ChoiceWhat are the 4 nitrogen bases?adenine, thymine, cytoplasm, and guanineadenine, thymine cytosine, and guanineadenine, thymine, cytosine, and gylceroladenine, thymine, cytosine, and glucose
- 11. Multiple ChoiceWhat determines the code, or information, of a DNA molecule?the shape (structure) of the nitrogen basesthe order (sequence) of the nitrogen basesthe color of the nitrogen basesthe frequency (number) of nitrogen bases
- 12. Multiple ChoiceWhich 2 molecules form the sides (backbone) of the DNA ladder?deoxyribose and adeninedeoxyribose and a hydrogen bonddeoxyribose and the nucleusdeoxyribose and phosphate
- 13. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuolechloroplastnucleus
- 14. Multiple ChoiceName this structuredouble helixnucelotidetwisted ladderhydrogen bond
- 15. Multiple ChoiceDNA codes for...cholesterolproteinsfatty acidsa sandwich
- 16. Multiple ChoiceNitrogenous bases are joined by which type of bond?polar bondsionic bondscovalent bondshydrogen bonds
- 17. Multiple ChoiceNucleotides are made up of a sugar, phosphate, and..?nitrogenous basenucleic acidcholesterolfatty acid
- 18. Multiple ChoiceWhat is the relationship between a protein, the cell, and DNA?DNA is produced by protein which is produced in the cellProtein is composed of DNA which is produced in the cellDNA controls the production of protein in the cellA cell is composed of DNA and protein
- 19. Multiple Choicethe base that pairs with Thymine in DNAadenineguaninehelicasenucleotide
- 20. Multiple Choicenitrogen base that pairs with guanineadeninecytosinenucloetidedeoxyribose
- 21. Multiple ChoiceA five-carbon sugar found in DNA.riboseguaninedeoxyribosehelicase
- 22. Multiple Choice(deoxyribonucleic acid); genetic material that organisms inherit from their parents.RNADNAdeoxyribosedouble helix
- 23. Multiple Choicemonomer of nucleic acid; consisting of a sugar, phosphate, and nitrogen basenucleotideguaninedeoxyriboseDNA
- 24. Multiple ChoiceThe four types of nucleotides that make up DNA are named for their:hydrogen bondsnitrogenous basesphosphate groupring-shaped sugars
- 25. Multiple ChoiceWhich model of base pairing is correct?A=T and C=GA=T=C=GA+T and G+CA=G and T=C
- 26. Multiple ChoiceWatson & Crick discovered the structure of DNA. They called it the _____________model:helicaldouble-helixdouble-strandedtwisted ladder
- 27. Multiple ChoiceIf base-pairing rules state that Adenine always pairs with Thymine, and Cytosine pairs with Guanine, what would be the complementary strand to ACGGT?ACGGTTGGCATGCCAACCGT
- 28. Multiple ChoiceWhich nucleotides are considered purines?Adenine & ThymineCytosine & GuanineAdenine & GuanineCytosine & Thymine
- 29. Multiple ChoiceBase pairs in a DNA strand are held together by what type of bonds?covalenthydrogenionicJames
- Answer choicesTagsAnswer choicesTags