Have an account?
Skip to Content
Build your own quiz
Suggestions for you
15 questions
Show Answers
See Preview
- 1. Multiple Choice
The passing of physical characteristics from parents to offspring.
hybrid
heredity
reviewing
purchasing
- 2. Multiple Choice
According to the Punnett Square, what is the percent probability that the parents will have heterozygous children.
100%
50%
25%
0%
- 3. Multiple Choice
A= Long Lashes
a= Short Lashes
According to the Punnett Square, what is the probability that the offspring will have have long lashes?
100%
75%
50%
25%
- 4. Multiple Choice
B= Dimples
b= No Dimples
Which of the following statements is true?
the father's phenotype is dimples
there is an 100% probability that the offspring will have dimples
there is a 50% probability that the offspring will not have dimples
bb is heterozygous
- 5. ReorderWhich of the following is the correct organization of genetic material from largest to smallest?
nucleus
chromosomes
genes
DNA
- 6. Multiple ChoiceHeredity is the passing of traits from _____________________ to _____________________predators to preywater to rainparents to offspringfungi to protists
- 7. Multiple Choice
Crossing over in organisms is responsible for...?
Dominance of genes
Recombination of genes
Linkage
Segregation of alleles
- 8. Multiple ChoiceWhich sequence of DNA bases would pair with this partial strand
ATG TGA CAGATG TGA CAGTAC ACT GTCGTA AGT GACCAT TCA CTG - 9. Multiple ChoiceWhich of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil
- 10. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 11. Multiple ChoiceWhich 2 molecules form the sides (backbone) of the DNA ladder?deoxyribose sugar and adeninedeoxyribose sugar and a hydrogen bonddeoxyribose sugar and the nucleusdeoxyribose sugar and phosphate
- 12. Multiple ChoiceWhat is the correct complimentary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC
- 13. Multiple ChoiceWhy is it crucial that living things are able to replicate their DNA?Each cell must have its own DNALess copies of DNA are needed when a new cell is createdA cell needs multiple copies of DNAOnly muscle cells need DNA
- 14. Multiple ChoiceWhat does DNA stand for?Deoxyribonucleic acidDenitrogenous acidDeribonucleic acidDiribonucleic acid
- 15. Multiple ChoiceWhat are the three components of a nucleotide?sugar, hydrogen, nitrogen basesugar, oxygen, nitrogen basesugar, phosphate, nitrogen basesugar, phosphate, protein
- Answer choicesTagsAnswer choicesTags