Have an account?
Skip to Content
Build your own quiz
20 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhich field would most likely NOT incorporate biotechnology?AgricultureGeneticsMedicineMining
- 2. Multiple ChoiceWhich of these has to do with genetic modification?CrossbreedingKidney surgeryGene splicinguse of herbicides
- 3. Multiple ChoiceA genome ispart of a chromosomea gene inserted into a chromosome of bacteriaa sequence of units in a short segment of DNAthe complete sequence of an organism’s DNA
- 4. Multiple Choice
Which of the following is used to cut DNA from organisms?
Gel Electrophoresis
Restriction Enzymes
Karyotypes
Haplotypes
- 5. Multiple Choice
A DNA molecule produced by combining DNA from different sources is called?
Mutant DNA
Polyploid DNA
Diploid DNA
Recombinant DNA
- 6. Multiple Choice_________________ is NOT a common ethical concern related to human cloning.That humans will be created who exist solely as a supply of organs for transplantsThat clones will be more prone to abnormal developmentThat parents will pay to have a child that is a clone of a famous athleteThat cloned humans will have no personality
- 7. Multiple Choice
A genetically engineered organism that contains a new gene from a different organism is called?
Bacterial
Genetic
Transgenic
Multigenic
- 8. Multiple Choice
Why is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy - 9. Multiple Choice
If scientists engineer the DNA of tomatoes to make them survive in cold temperatures, what do type of technology do those tomatoes become?
Human Genome Project
Genetically Modified Organisms
Punnett Squares
Gene Therapy
- 10. Multiple Choice
Bacteria cells can be used to produce insulin for the treatment of diabetes in humans. Which best explains how the bacteria cells are able to produce insulin for humans?
The bacteria have been grown on a petri dish containing insulin.
The bacteria have been genetically engineered to contain the DNA needed to produce insulin.
The bacteria have been exposed to radioactivity to create mutant strains capable of producing insulin.
The bacteria have been grown on a petri dish containing sugar; the bacteria produce insulin in response to the sugar.
- 11. Multiple ChoiceWhich option most closely relates to how CRISPR works?"shake and bake""cut and paste""hide and seek""live and love"
- 12. Multiple ChoiceWhat was the first cloned animal?Dolly the SheepRobby the RatMilton the MouseBeth the Goat
- 13. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuoleribosomenucleus
- 14. Multiple ChoiceWhat are the three components of a nucleotide?sugar, hydrogen, nitrogen basesugar, oxygen, nitrogen basesugar, phosphate, nitrogen basesugar, phosphate, protein
- 15. Multiple ChoiceWhat will the matching sequence be on a strand that reads AAGCTAT?AACGATATTCGTTACCTGATATTCGATA
- 16. Multiple ChoiceWhen human DNA is inserted in bacterial DNA to create insulin it is calledviral DNAbacterial DNArecombinant DNAtranscribed DNA
- 17. Multiple Choice
The purpose of selective breeding is to
get bigger animals
get smaller animals
create animals with desirable traits
create animals with bad traits
- 18. Multiple Choice
Problems with selective breeding include
Better animals
More Meat
Animals can have bad health problems
More diversity
- 19. Multiple ChoiceWhat is one way CRISPR has already been used to change genes?Clone sheepGive people superpowersCure animal diseasesMilitary purposes
- 20. Multiple Choice
What is a GMO?
An organism that has had its DNA modified by humans
An organism missing a chromosome
Epigenetics
A genetically identical organism
- Answer choicesTagsAnswer choicesTags