Have an account?
Skip to Content
Build your own quiz
7 questions
Show Answers
See Preview
- 1. Multiple Choice
California forests, such as Yosemite and Redwoods contain some of the tallest trees in the world, reaching more than 360 feet Tall. Which property of water causes it to be transported up to the top of a redwood tree?
hydrogen bonding
cohesive behavior
versatility as a solvent
can moderate temperature
- 2. Multiple Choice
Many people enjoy vacationing in places like Florida because the environment experiences subtle changes in weather throughout the year as opposed to environments located more inland. Which characteristic of water allows places like Florida to remain temperate throughout the year?
versatility as a solvent
high surface tension
specific heat capacity
expansion on freezing
- 3. Multiple Choice
You are conducting a science experiment in class and your Teacher wants you to test an unknown food item. She asks you to find out what type of macromolecule it is. You find that the substances structure consists of carbon, hydrogen, and oxygen. While testing the substance you notice it displays a hydrophobic behavior. After you test the substance in a calorimeter, you find that it contains a lot of energy. Which type of macromolecule is the unknown substance you are testing in the lab?
carbohydrate
lipid
protein
nucleic acid
- 4. Multiple Choice
A student in class noticed the teacher was mixing a drink that looked like a chocolate shake before class began. The student asked what she was drinking, knowing that it was probably some kind of sports drink. The teacher explained that it is a whey protein shake for people that exercise a lot and it helps with muscle recovery.
Which of the following best describes the molecular structure of whey protein?
a ring of 6 carbon atoms.
a molecule of amino acid chains twisted around itself
a molecule of glycerol with three chains of fatty acids attached
a sugar-phosphate backbone with a sequence of nitrogenous bases attached to it.
- 5. Multiple Choice
The picture below shows the steps of DNA replication beginning with step one and ending with step three.
Because you are reusing the old, or parent, DNA strand DNA replication is said to be
Semi- Conservative
Semi-discontinuous
Continuous
Fully-Conserveative
- 6. Multiple ChoiceA scientist observes a base sequence of AGCTAGCTAGCT. Which of the following would be the complimentary strand?TGCATGCATGCATCGATCGATCGATAGCTAGCTAGCTTAAGGCCTTCC
- 7. Multiple ChoiceWhat will the first four bases of the new DNA strand look like if copying the template strand?TGGTACCAGTTGCAAC
- Answer choicesTagsAnswer choicesTags