Have an account?
Skip to Content
Build your own quiz
15 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhat does DNA stand for?Deoxyribonucleic acidDenitrogenous acidDeribonucleic acidDiribonucleic acid
- 2. Multiple Choice
Which of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil - 3. Multiple ChoiceDNA is a polymer made of:NucleotidesRibosomesPurinesPyrimidines
- 4. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 5. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 6. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuoleribosomenucleus
- 7. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 8. Multiple ChoiceWhat will the matching sequence be on a strand that reads AAGCTAT?AACGATATTCGTTACCTGATATTCGATA
- 9. Multiple ChoiceWhat are the three components of a nucleotide?sugar, hydrogen, nitrogen basesugar, oxygen, nitrogen basesugar, phosphate, nitrogen basesugar, phosphate, protein
- 10. Multiple ChoiceDNA codes for...basesproteinsamino acidsphosphates
- 11. Multiple Choice
A change in a DNA sequence(order) that affects genetic information.
Recessive trait
Mutation
Allele
- 12. Multiple Choicethe process of making a copy of DNAtranscriptiondouble helixDNA replicationreplication fork
- 13. Multiple ChoiceWhich shows the correct complementary base pairing for DNA?C-A, T-GA-G, C-TC-G, U-AT-A, G-C
- 14. Multiple Choice
What shape is DNA?
a circle
a triangle
a double helix
- 15. Multiple Choice__________________ is a change in the nucleotide base sequence of DNA.switcherasercreationmutation
- Answer choicesTagsAnswer choicesTags