Have an account?
Skip to Content
Build your own quiz
Biology, Science
9th -
12thgrade
DNA/Replication and Transcription/Translation
39 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhat are the nucleotides made of?Sugar, Phosphate, nitrogen basePhosphate, Adenine, nitrogen baseThymine, Adenine, CytominePhosphate, Nitrogen, Adenine
- 2. Multiple ChoiceWhich of the following units are repeatedly joined together to form a strand of DNA? (This is the MONOMER of DNA.)amino acidsnucleotidesfatty acidspolysaccharides
- 3. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 4. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 5. Multiple ChoiceWhat are the 4 nitrogen bases?adenine, thymine, cytoplasm, and guanineadenine, thymine cytosine, and guanineadenine, thymine, cytosine, and gylceroladenine, thymine, cytosine, and glucose
- 6. Multiple ChoiceWhich 2 molecules forms the sides (backbone) of the DNA ladder?deoxyribose and adeninedeoxyribose and a hydrogen bondsugar and the nucleusdeoxyribose (sugar) and phosphate
- 7. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuolechloroplastnucleus
- 8. Multiple ChoiceWhich sequence of DNA bases would pair with this partial strand
ATG TGA CAGATG TGA CAGTAC ACT GTCGTA AGT GACCAT TCA CTG - 9. Multiple ChoiceWhat determines the code, or information, of a DNA molecule?the shape (structure) of the nitrogen basesthe order (sequence) of the nitrogen basesthe color of the nitrogen basesthe frequency (number) of nitrogen bases
- 10. Multiple ChoiceNitrogenous bases are joined by which type of bond?polar bondsionic bondscovalent bondshydrogen bonds
- 11. Multiple ChoiceThe enzyme that unzips the DNA to prepare for replicationhelicasereplicasepolymerasesynthase
- 12. Multiple ChoiceDNA replication results in two DNA molecules,each one with two original strandseach one with two new strandseach one with one new strand and one original strandone with two new strands and the other with two original strands
- 13. Multiple Choiceorder of replication3, 2, 1, 42, 1, 4, 32, 3, 1, 43, 4, 1, 2
- 14. Multiple ChoiceA process in which DNA has the unique ability to make an exact copy of itself.ReplicationTranslationTranscription
- 15. Multiple ChoiceWhat is the correct complimentary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC
- 16. Multiple ChoiceWhich enzyme is responsible for adding nucleotides?TopoisomeraseDNA PolymeraseLigasePrimase
- 17. Multiple ChoiceHow can a person's muscle cells have the same exact DNA sequences as their nerve cells even though the look and perform completely different?The two different cells become mutatedThe proteins expressed in each cell are differentThey actually have different DNA in the two types of cells.The genome of the different cells changes
- 18. Multiple ChoiceIf an mRNA molecule has introns and exons in it, where is it?At a ribosomeIn the nucleusIn a prokaryotic cellcould be in the nucleus or the ribosome
- 19. Multiple Choice_______ is to transcription as ________ is to translation.mRNA / Amino Acid ChainAmino Acid Chain / mRNARibosome / NucleusmRNA / tRNA
- 20. Multiple ChoiceWhat structure of this molecule binds with the mRNA molecule?Amino AcidtRNAAnticodonCodon
- 21. Multiple Choice
Which RNA type is the result of transcription?
tRNA
Non-coding RNA
rRNA
mRNA
- 22. Multiple Choice
Which of the following is correct?
Nucleotide triplets code a single amino acid.
Each amino acid codes a nucleotide.
Each nucleotide codes an amino acid.
Amino acid triplets code a single nucleotide.
- 23. Multiple Choice
RNA substitutes uracil for which nucleotide?
Adenine
Cytosine
Guanine
Thymine
- 24. Multiple Choice
Translation is a process where:
a polypeptide sequence is produced from a sequence of rRNA codons.
a polypeptide sequence is produced from a sequence of tRNA codons.
a polypeptide sequence is produced from a sequence of mRNA codons.
a DNA nucleotide sequence is used to produce mRNA codon sequence.
- 25. Multiple ChoiceWhich of these processes begin with an mRNA molecule?DNA ReplicationTranscriptionTranslationNone of them
- 26. Multiple Choice
What part of a eukaryotic gene often has a TATA box?
primer
promoter
signal peptide
terminator
- 27. Multiple Choice
Which number represents a tRNA in the P site?
1
2
3
4
- 28. Multiple Choice
What is the non-coding portion of the mRNA transcript that is removed during processing?
intron
exon
5'cap
poly-A tail
- 29. Multiple Choice
In what direction is a trancript made?
3' to 5'
5' to 3'
3' to 3'
5' to 5'
- 30. Multiple Choice
Which number represents the part made of rRNA?
2
4
6
7
- 31. Multiple Choice
Transcription requires _____ for RNA polymerase to bind to DNA.
primers
transcription factors
promoter
TATA box
- 32. Multiple ChoiceHow would the DNA sequence GCTATA be transcribed to mRNA?GCUAUACGATATCGAUAUGCUTUT
- 33. Multiple Choice
What is Transcription?
The making DNA segment.from mRNA.
The making of an RNA strand into a protein.
The making of an mRNA strand from the DNA template.
- 34. Multiple ChoiceAmino acids are the building blocks of...DNARNAAtomsProteins
- 35. Multiple Choice
Where are proteins made?
muscles
nucleus
outside the nucleus in the cytoplasm
- 36. Multiple Choice
These chemical tags inactivate or silence a gene.
acetyl groups
methyl groups
histones
genes
- 37. Multiple ChoiceWhat is a Gene?A segment of RNA that encodes for a proteinA chromosomeA segment of DNA that encodes for a proteinYour genome
- 38. Multiple Choice
How many bases make up a codon?
1
2
3
4
- 39. Multiple Choice
Which of the following are coding regions of an mRNA transcript?
Introns
Exons
- Answer choicesTagsAnswer choicesTags