Have an account?
Skip to Content
23 questions
Show Answers
See Preview
- Multiple ChoicePlease save your changes before editing any questions.What type of RNA carries the DNA message out of the nucleus to the ribosomes?mRNAtRNARNADNA
- Multiple ChoicePlease save your changes before editing any questions.What do we call the process of turning DNA into mRNA?TranslationTranscriptionReplication
- Multiple ChoicePlease save your changes before editing any questions.When DNA is transcribed to RNA....A pairs with UC pairs with UA pairs with TC pairs with T
- Multiple ChoicePlease save your changes before editing any questions.Amino acids are the building blocks of...DNARNAAtomsProteins
- Multiple ChoicePlease save your changes before editing any questions.In translation, C pairs withUGAT
- Multiple ChoicePlease save your changes before editing any questions.Which of the following best describes a DNA molecule?contains ribosemade of amino acidscontains Uracildouble helix
- Multiple ChoicePlease save your changes before editing any questions.Where does transcription take place?nucleuscytoplasmribosome
- Multiple ChoicePlease save your changes before editing any questions.One difference between DNA and RNA is that....Only RNA has the base Uracilonly RNA contains the base Thymineonly RNA contains the base Cytocineonly RNA contained the base Guanine
- Multiple ChoicePlease save your changes before editing any questions.True or false: RNA is double-stranded.truefalseit depends on the type
- Multiple ChoicePlease save your changes before editing any questions.Which of these bases does not exist in RNA?CTUA
- Multiple ChoicePlease save your changes before editing any questions._______ is made during transcription and ________ is made during translation.mRNA / a proteina protein / mRNARibosome / NucleusmRNA / tRNA
- Multiple ChoicePlease save your changes before editing any questions.
If a strand of DNA had bases in the following order - ATCCGTC, what would be the replicated complementary strand?
UAGGCAG
ATCCGTC
TAGGCAG
TUGGCTG
- Multiple ChoicePlease save your changes before editing any questions.What causes mutations?Mistakes in replication or environmental substancesThe amino acidsPassed down by geneticsIt's how your born
- Multiple ChoicePlease save your changes before editing any questions.
A mutation can occur if a base pair is ____________, deleted, or substituted for another.
modified
added
transferred
- Multiple ChoicePlease save your changes before editing any questions.
Mutations are SOMETIMES helpful to the organism.
true
false
- Multiple ChoicePlease save your changes before editing any questions.
What is DNA made of?
Sugar, Phosphate, nitrogen base
Phosphate, Adenine, nitrogen base
Thymine, Adenine, Cytomine
Phosphate, Nitrogen, Adenine
- Multiple ChoicePlease save your changes before editing any questions.Adenine bonds with ______________.GuanineThymineCytosineAdenine
- Multiple ChoicePlease save your changes before editing any questions.Guanine bonds with ______________.AdenineGuanineCytosineThymine
- Multiple ChoicePlease save your changes before editing any questions.
What are the 4 nitrogen bases?
adenine, thymine, cytoplasm, and guanine
adenine, thymine, cytosine, and guanine
adenine, thymine, cytosine, and gylcerol
adenine, thymine, cytosine, and glucose
- Multiple ChoicePlease save your changes before editing any questions.Which 2 molecules forms the sides (backbone) of the DNA ladder?deoxyribose and adeninedeoxyribose and a hydrogen bondsugar and the nucleusdeoxyribose (sugar) and phosphate
- Multiple ChoicePlease save your changes before editing any questions.
Why is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy - Multiple ChoicePlease save your changes before editing any questions.DNA replication results in two DNA molecules,each one with two original strandseach one with two new strandseach one with one new strand and one original strandone with two new strands and the other with two original strands
- Multiple ChoicePlease save your changes before editing any questions.What is the correct complimentary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC