Have an account?
Skip to Content
Build your own quiz
Suggestions for you
64 questions
Show Answers
See Preview
- 1. Multiple Choice
A water strider can skate along the top of a pond because:covalent bonds result in water cohesionhydrogen bonds result in water cohesion (surface tension)water striders have adapted to take advantage of water cohesionlow surface tension of water - 2. Multiple ChoiceWhat word describes when water is attracted to other substances?cohesionadhesioncapillary actionsurface tension
- 3. Multiple ChoiceWhat two elements make up water?Helium and oxygenHydrogen and oxygenhelium and carbonoxygen and carbon
- 4. Multiple ChoiceWhy can water have no net charge but have slight charges in different parts of the molecule?The oxygen end is slightly negative and the hydrogen end is slightly positiveThe hydrogen end is slightly negative and the oxygen end is slightly positiveThe hydrogen and oxygen ends change in polarityBecause it is hydrophobic
- 5. Multiple ChoiceAttractions between water molecules are calledCovalent bondsIonic bondsPolar bondsHydrogen bonds
- 6. Multiple ChoiceThe attraction that causes water and other liquids to form drops on thin films is called ________________. This is also water’s ability to be attraction to other water molecules.adhesioncapillary actioncohesionsurface tension
- 7. Multiple ChoiceWhich is NOT a unique property of water?Frozen water floats on liquid water.Water covers most of the Earth’s surface and retains a large amount of heat.Water molecules stick to each other through hydrogen bonds.Water cools very rapidly.
- 8. Multiple ChoiceWater is polar because...The unequal sharing of electrons gives the water molecule a slight negative charge near its oxygen atom and a slight positive charge near its hydrogen atoms.The molecule has two poles, at which the it is colder than other regions of the molecule.The unequal sharing of electrons gives the water molecule a slight negative charge near its hydrogen atoms and a slight positive charge near its oxygen atom.The water molecule is neutral.
- 9. Multiple Choicemolecule in which opposite ends have opposite electric chargescohesionpolar moleculehydrogen bondsolution
- 10. Multiple ChoiceWhy does ice float?As water freezes, it expands and its density decreases.As water freezes, it takes up more hydrogen from the atmosphere, causing it to have a greater buoyancy.As water freezes, air becomes trapped between the hydrogen bonds of water molecules.As water freezes, it takes up more oxygen from the atmosphere, causing it to have a greater buoyancy.
- 11. Multiple ChoiceWhich end of the water molecule has a slightly positive charge?the oxygen endthe hydrogen endboth ends are slightly positiveneither end is positive
- 12. Multiple ChoiceWhich of the following is LEAST likely to dissolve in water?nonpolar fats and oilspolar sugar moleculessalt made of a positive sodium ion and a negative chloride ionall of the substances will dissolve easily in water
- 13. Multiple ChoiceWhich characteristic of water will allow a paperclip to remain floating on water when the paperclip is gently placed on top of the water?adhesionsurface tensionsolvent propertiesnonpolar
- 14. Multiple ChoiceWhich statement best describes an effect of the low density of frozen water in a lake?When water freezes, it contracts, decreasing the water level in a lake.Water in a lake freezes from the bottom up, killing most aquatic organisms.When water in a lake freezes, it floats, providing insulation for organisms below.Water removes thermal energy from the land around a lake, causing the lake to freeze.
- 15. Multiple ChoiceWhich types of compounds dissolve easily in water?Polar and NonpolarPolar and IonicNonpolar and IonicCovalent and Nonpolar
- 16. Multiple ChoiceWhat property of water helps to moderate earth's temperature?adhesionchohesionSpecific heat capacityLatent heat of vaporization
- 17. Multiple ChoiceThe ability of water to move through and around substances is called? (Examples: Water moving through a paper towel; water being transported from the roots to the top leaves of a tree.)Capillary actionCohesion actionConcave actionNone of the above
- 18. Multiple ChoiceHow are covalent bonds explained?When one atom takes the other atom's electronWhen the atom shares an electron with an another atomWhen the two nucleus mergeWhen the neutrons leave the nucleus
- 19. Multiple ChoiceDiatomic elements are defined as IDENTICAL elements that bond with each other (i.e. Oxygen with Oxygen). What do we call it when this forms?CompoundMoleculeAtomNone of the above
- 20. Multiple Choice
a major component of genes and proteins
nitrogen
sulfur
iron
oxygen
- 21. Multiple ChoiceWhich of the following contains the genetic code for protein synthesis?carbohydratelipidproteinnucleic acid
- 22. Multiple ChoiceWhat type of macromolecule is being represented in this image?carbohydratelipidproteinnucleic acid
- 23. Multiple ChoiceWhat are the building blocks of proteins?amino acidfatty acidnucleotidelipid
- 24. Multiple ChoiceWhat are the single sugars that are the building blocks of carbohydrates?monosaccharidesdisaccharidespolysaccharidesamino acid
- 25. Multiple ChoiceWhy are lipids insoluble in water?lipids are polarlipids are non-polarlipids have a negative chargelipids are building blocks of protiens
- 26. Multiple ChoiceREVIEW: Why will salt form a solution with water but sand will not?Salt is polar, while sand is non-polarSalt is non-polar, while sand is polarSalt and sand are polarSand is more coarse than salt
- 27. Multiple ChoiceWhich of the four major biological macromolecules can be easily identified by the nitrogen base and phosphate found in its structure?carbohydratelipidproteinnucleic acid
- 28. Multiple ChoiceDNA and RNA are examples ofCarbohydratesLipidsProteinsNucleic Acids
- 29. Multiple ChoiceNucleotides are monomers ofCarbohydratesLipidsProteinsNucleic Acids
- 30. Multiple ChoiceMonosaccharides are monomers ofCarbohydratesLipidsProteinsNucleic Acids
- 31. Multiple ChoiceWaxes, oils and fats are examples ofCarbohydratesLipidsProteinsNucleic Acids
- 32. Multiple ChoiceWhat is the function of nucleic acids?store genetic informationstore energy (long-term)store energy (short-term)build skin, hair, nails, muscles
- 33. Multiple ChoiceWhich of the following organic compounds is the main source of energy for living things?carbohydrateslipidsnucleic acidsproteins
- 34. Multiple ChoiceWhich macromolecule stores energy, insulates us, and makes up the cell membrane?lipidsproteinscarbohydratesnucleic acids
- 35. Multiple ChoiceLipids can be digested into what smaller subunits?nucleic acidsamino acidsfatty acidsglucose
- 36. Multiple ChoiceAll polymers are made up of...monosaccharidesmonomersproteinsNone of these
- 37. Multiple ChoiceAll organic compounds contain the elementcarbonnitrogenphosphorussulfur
- 38. Multiple Choice
Enzymes belong to which class of macromolecules?
lipids
carbohydrates
proteins
nucleic acids
- 39. Multiple Choice
Sugar belongs to which class of macromolecules?
proteins
lipids
nucleic acids
carbohydrates
- 40. Multiple ChoiceWhat is the primary function of carbohydrates in your body?Speed up chemical reactions.Give immediate energy.Help to store energy.Build cell walls in plants.
- 41. Multiple ChoiceWhat are the four macromolecules?proteins, nucleic acids, carbohydrates, and lipidsmonosaccharides, lipids, polysaccaharides, and proteinsRNA, DNA, proteins, and carbohydratesproteins, DNA, RNA, and steroids
- 42. Multiple ChoiceWhat is the difference between DNA and RNA from the point of view of the nitrogenous bases that are present in their nucleotides?In DNA, nucleotides can be made up of A, T, C, G. In RNA, nucleotides can also contain A, C or G; however, instead of T, they contain U.Purine and PyrimidinePyrimidine: Thymine, Cytosine (Urical)DNA, RNA
- 43. Multiple ChoiceRNA contains the sugar...DeoxyriboseGlucoseRiboseLipids
- 44. Multiple ChoiceIs this hydrocarbon saturated or unsaturated?saturatedunsaturated
- 45. Multiple ChoiceWhich of the following is a purine?CytosineThymineAdenine
- 46. Multiple ChoiceGuanine is complementary to what other nitrogenous base?CytosineAdenineThymineUracil
- 47. Multiple ChoiceIf a cell has 20% Adenine in it, what % of Cytosine must it have?10%20%30%80%
- 48. Multiple ChoiceWhen coiled together, DNA looks like a:Single HelixDouble HelixTriple HelixBroken Ladder
- 49. Multiple ChoiceIf one series of bases reads: TTGACTAGG, then the complementary set of bases would read:TTGACTAGGAACTGATCCAATCGAACTTAAGTCATCC
- 50. Multiple ChoiceIf a hydrophobic amino acid sequence is placed in water the amino acids willfold in halfunfoldbunch upspread out
- 51. Multiple ChoiceThe level of protein structure that results from hydrogen bonding causing the protein to fold into α-helix and β-pleated sheets is known asprimary structuresecondary structuretertiary structurequaternary structure
- 52. Multiple ChoiceThe name of the initial chain of monomers in a protein is called.....polypeptidepolysaccharidepolyesterpolynucleotide
- 53. Multiple ChoiceThe main bonding in the secondary structure of a protein is due to.....covalent bondingionic bondinghydrogen bondingpolar bonding
- 54. Multiple ChoiceThe tertiary structure folding in proteins is primary due to the interactions of....the 'R' groupsthe 'P' groupsthe 'A' groupsthe 'S'
- 55. Multiple ChoiceHow many different amino acids are there?15202530
- 56. Multiple ChoiceWhen a protein unfolds, it isDenaturedBuildingAdding amino acidsMaking food
- 57. Multiple ChoiceWhat is a peptide bond?Bond that holds two amino acids together.A bond that holds hydrogen and oxygen molecules together.A bond that holds the phosphate group of one nucleotide and a sugar of a neighboring nucleotide.A bond that is formed by the sharing of electrons.
- 58. Multiple ChoiceWhich structure changes in the 20 different amino acids?#1#2#3#4
- 59. Multiple ChoiceWhich letter corresponds to an alpha helix?ABCD
- 60. Multiple ChoiceWhich letter corresponds to an beta sheet?ABCD
- 61. Multiple ChoiceWhich letter corresponds to the primary protein structure?ABCD
- 62. Multiple ChoiceCarbon chains are principal features of both carbohydrates and lipids. What is the primary difference between these two types of macromolecules?Lipids always have longer carbon chains than carbohydrates.Carbohydrates cannot form rings like lipids can.Lipids provide energy, but carbohydrates cannot.Carbohydrates form ring structures, lipids form long chains
- 63. Multiple ChoiceSaturated fats are __________ at room temperature.liquidgasesplasmasolid
- 64. Multiple ChoiceWhich macromolecule is this?carbohydratelipidproteinnucleic acid
- Answer choicesTagsAnswer choicesTags