Have an account?
Skip to Content
Build your own quiz
Suggestions for you
20 questions
Show Answers
See Preview
- 1. Multiple Choice
This laboratory procedure is known as
CLONING
gel electrophoresis
chromatography
use of a dichotomous key
- 2. Multiple Choice
In preparation for an electrophoresis procedure, enzymes are added to DNA in order to
convert the DNA into gel
cut the DNA into fragments
change the color of the DNA
produce longer sections of DNA
- 3. Multiple Choice
The diagram represents the results of the procedure known as
cloning
chromatography
gel electrophoresis
protein sequencing
- 4. Multiple Choice
The parents of a new baby believe they brought the wrong child home from the hospital. Gel electrophoresis was performed using DNA samples from the parents and the child. A section of the gel
electrophoresis results is shown below. Which conclusion is valid based on the gel electrophoresis results?
They have the correct child, because her genetic information is identical to that of the father.
They have the wrong child, because her genetic information does not match that of either parent.
They have the correct child, because her genetic information came from both parents.
They have the wrong child, because her genetic information matches only that of the mother.
- 5. Multiple Choice
Base your answer to the following question on the diagram below, which represents a portion of a type of organic molecule present in the cells of organisms. This laboratory technique is known as
gel electrophoresis
DNA replication
protein synthesis
genetic recombination
- 6. Multiple Choice
What is this technique an example of?
chromatography
gel electrophoresis
direct harvesting
genetic engineering
- 7. Multiple Choice
The results of which laboratory technique are represented in the diagram?
chromatography
manipulation of genes
genetic engineering
gel electrophoresis
- 8. Multiple Choice
A technique that can be used to compare the DNA of two or more plants is
cloning
chromatography
staining
gel electrophoresis
- 9. Multiple Choice
A student performed a gel electrophoresis experiment. The results are represented in the diagram
below. Compared to the fragments at the top of the gel, the fragments at the lower end are
larger, and move slower
larger, and move faster
smaller, and move faster
smaller, and move slower
- 10. Multiple Choice
Which chemicals are used to cut DNA into fragments for a gel electrophoresis procedure?
enzymes
molecular bases
hormones
ATP molecules
- 11. Multiple Choice
This technique used to analyze DNA involves the
synthesis of new DNA strands from subunits
separation of DNA fragments based on size
production of genetically engineered DNA molecules
removal of defective genes from DNA
- 12. Multiple Choice
What is this technique an example of?
chromatography
gel electrophoresis
direct harvesting
genetic engineering
- 13. Multiple Choice
Gel electrophoresis is used to separate DNA fragments on the basis of which property?
size
color
functions
chromosomes
- 14. Multiple Choice
Sample 1: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC
Sample 2: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATCThe results of DNA analysis are often used to help determine
the number of DNA molecules in an organism
if two species are closely related
the number of mRNA molecules in DNA
if two organisms contain carbohydrate molecules
- 15. Multiple Choice
A product of genetic engineering technology is represented below . Which substance was needed to join the insulin gene to the bacterial DNA as shown?
a specific carbohydrate
a specific enzyme
hormones
antibodies
- 16. Multiple Choice
. Which process is illustrated in the diagram below?
chromatography
direct harvesting
meiosis
genetic engineering
- 17. Multiple Choice
Which set of terms correctly identifies the procedure
shown in the diagram below and a substance
produced by this procedure?
selective breeding-growth hormone
cloning-antibiotics
genetic engineering-insulin
replicating-glucose
- 18. Multiple Choice
What is the result of step 3?
a new type of molecular base is formed
different types of minerals are joined together
DNA from the bacterial cell is cloned
DNA from different organisms is joined together
- 19. Multiple Choice
The arrows in the diagram below indicate the development of four different varieties of vegetable plants from wild mustard.Each of these varieties was most likely produced as a result of
asexual reproduction in the wild for many years
changes in light availability
competition between plants
selective breeding over many generations
- 20. Multiple Choice
This diagram below represents a process that occurs in nature.This diagram can be used to illustrate the
effects of reduced competition between different types of plant life
effect of human intervention on a stable ecosystem
ecological succession from bare rock to stable ecosystem
evolution of mosses to trees over 200 years
- Answer choicesTagsAnswer choicesTags