Have an account?
Skip to Content
Build your own quiz
15 questions
Show Answers
See Preview
- 1. Multiple ChoiceThe two strands of a DNA molecule are held together by ________ bonds between their base pairs.covalenthydrogenionicpeptide
- 2. Multiple ChoiceWhich of the following is not a base found in DNA?adeninethyminecytosineuracil
- 3. Multiple ChoiceWhat part of a nucleotide accounts for the genetic variation between individuals?phosphatenitrogenous basedeoxyribosesugar
- 4. Multiple ChoiceIf a segment of double-stranded DNA has 40 percent A, how much of it is C?40101520
- 5. Multiple ChoiceIf one strand of DNA has the sequence TTACCG, the sequence of the other strand of the same molecule will beAATGGCTTACCGAACGGCAATGGG
- 6. Multiple ChoiceOnce replication in a DNA molecule is complete, each new DNA molecule containstwo new strands.3 exact copies of strands.one new strand and one old.two old strands.
- 7. Multiple ChoiceThe polymerase chain reaction (PCR) is used toinsert DNA from one organism into a new host.screen for a particular gene.produce many copies of a selected DNA sequence.
- 8. Multiple ChoiceWhich of the following will NOT generally cause mutations?radiationDNA replicationchemicalsviruses
- 9. Multiple ChoiceWhich enzyme copies DNA?DNA polymeraseDNA helicaseRNA polymeraseRNA helicase
- 10. Multiple ChoiceWhat are the functions of genes?instructions for producing proteinsinstructions for producing DNAinstructions for producing lipidsthey have no function
- 11. Multiple ChoiceWhat does mRNA do?provides information from DNA to ribosomestransfers amino acids to the ribosomesmakes up ribosomesbuilds proteins
- 12. Multiple ChoiceWhat does rRNA do?provides information from DNA to ribosomestransfers amino acids to the ribosomesmakes up ribosomesbuilds proteins
- 13. Multiple ChoiceWhat does tRNA do?provides information from DNA to ribosomestransfers amino acids to the ribosomesmakes up ribosomesbuilds proteins
- 14. Multiple ChoiceWhat is the process that copies information from DNA into RNA?protein synthesistranscriptiontranslationDNA Polymerase
- 15. Multiple ChoiceWhat is the process that copies information from DNA into RNA?protein synthesistranscriptiontranslationDNA Polymerase
- Answer choicesTagsAnswer choicesTags