Have an account?
Skip to Content
Build your own quiz
Suggestions for you
35 questions
Show Answers
See Preview
- 1. Multiple ChoiceIf a drug targets cell growth and can keep cells from reproducing, what process does the drug most likely target?CancerCell RespirationCell DivisionDNA Replication
- 2. Multiple ChoiceWhat type of cells are formed by repeating the cell cycle continuously?CancerProkaryoticEukaryoticSomatic
- 3. Multiple ChoiceA lion contains 80 chromosomes. The number of chromosomes a lion egg cell, produced by meiosis, will be?40802060
- 4. Multiple Choice
What structure in animal cells is formed during cytokinesis that allows the cell to separate into two new daughter cells?
Cell Plate
Cleavage Furrow
Cell Wall
Cleavage plate
- 5. Multiple ChoiceA daughter cell that results from a mitotic division has 5 chromosomes. How many chromosomes did the parent cell have?5102.515
- 6. Multiple ChoiceThe list below describes some of the events associated with normal cell division.
1. Nuclear membrane formation around each set of newly formed chromosomes
2. Centrioles move to poles and nuclear envelope disappears
3. Replication of each chromosome
4. Movement of single stranded chromosomes to opposite ends of the spindle.
What is the normal sequence in which these events occur?3-4-2-11-2-3-43-2-4-14-3-1-2 - 7. Multiple ChoiceWhich phase of Mitosis do the sister chromatids line up in the middle of the cell?ProphaseMetaphaseAnaphaseTelophase
- 8. Multiple ChoiceTrue or False
Mutations do not occur during mitosis but they do occur during meiosisTrueFalse - 9. Multiple ChoiceTrue or False
Mitosis does not usually produce variation between offspring but meiosis doesTrueFalse - 10. Multiple Choice
This process represents what?MitosisMeiosisCellular RespirationPhotosynthesis - 11. Multiple ChoiceTrue or False
Meiosis occurs only in cells responsible for sexual reproductionTrueFalse - 12. Multiple ChoiceTrue or False
Meiosis happens in all tissues except the brain and spinal cordTrueFalse - 13. Multiple ChoiceTrue or False
The cells produced at the end of meiosis are genetically identical to the parent cellTrueFalse - 14. Multiple ChoiceTrue or False
The cells produced at the end of meiosis contain half the number of chromosomes as the parent cellTrueFalse - 15. Multiple ChoiceWhat happens during S phase of the cell cycle?DNA ReplicationGrowingCell Waits to DivideMitosis
- 16. Multiple ChoiceWhat is another name for a sex cell?GameteSomaticDiploidMitosis
- 17. Multiple ChoiceWhat process makes sex cells?MitosisMeiosis
- 18. Multiple ChoiceWhat process produces somatic cells?MitosisMeiosis
- 19. Multiple ChoiceWhat type of cells are somatic cells?Body cellsSex cells
- 20. Multiple ChoiceWhat phase of mitosis do you get 2 new nuclei?ProphaseMetaphaseAnaphaseTelophase
- 21. Multiple ChoiceWhat is the division of cytoplasm during the M phase of the cell cycle called?MetaphaseAnaphaseTelophaseCytokinesis
- 22. Multiple ChoiceWhich DNA strand is complementary to the one shown here? AGTCTAGCTCAGATCGAGTCTAGCTCACTAGCCGTACTAC
- 23. Multiple ChoiceOncogenes are mutated forms of genes. Oncogenes can transform a cell into a tumor cell. Some tumor cells are benign, while others are malignant. How does the presence of an oncogene lead to the formation of a tumor?ATP production is inhibited.Cell division is unregulated.Somatic cell growth is inhibited.Antibody activity is unregulated.
- 24. Multiple ChoiceCells pass through a G2 checkpoint before entering mitosis. Ideally, if DNA damage is detected, the cells do not enter mitosis until the damage is repaired. Why is DNA damage repaired before cells enter mitosis?So that another round of DNA synthesis does not have to take place.So that the chromosomes can align at the metaphase plate during mitosis.So that the cytoplasm can be divided equally between the two daughter cells.So that healthy daughter cells are produced, allowing the organism to continue growing.
- 25. Multiple ChoiceDuring meiosis, homologous chromosomes exchange genetic information. This exchange of genetic material –Increase the genetic variationReduces the diploid number to the haploid numberIncreases the haploid number to the diploid numberReduces the probability of mutations
- 26. Multiple ChoiceThe diagram shows cells in different phases of mitosis. A student is trying to find a cell in a particular phase of mitosis. The student is looking for evidence that spindle fibers are separating the chromosomes to ensure that each new nucleus has one copy of each chromosome. Which cell is in the phase of mitosis that the student is searching for?Cell 1Cell 2Cell 3Cell 4
- 27. Multiple ChoiceWhich process divides twice?MitosisMeiosis
- 28. Multiple Choice
A photomicrograph of onion root tip cells during mitosis is shown below. Which phase of mitosis is occurring in the cell indicated by the arrow?
Prophase
Metaphase
Anaphase
Telophase
- 29. Multiple Choice
Put the above pictures in order of cell division
1,2,3,4,5
5,4,3,2,1
2,5,1,4,3
2,5,1,3,4
- 30. Multiple Choice
Part of the cell cycle is shown in this simplified model. This part of the cell cycle is best described as the process that –
duplicates the DNA
completes cell division
maintains genetic homeostasis
synthesizes new molecules
- 31. Multiple Choice
Which of these occurs just before the cell enters G2 stage of the cell cycle?
The nuclear membrane disintegrates
DNA replicates
Centrioles form
The nucleolus divides
- 32. Multiple Choice
Which statement about the event represented in the diagram is valid?
The event represents RNA translation in the smooth endoplasmic reticulum
The event takes place in bacterial cells
The event produces genetically identical daughter cells
The event provides genetic diversity in eukaryotic cells
- 33. Multiple Choice
Which of the following lists the phases of the cell cycle in order?
Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis
Cytokinesis, Telophase, Anaphase, Metaphase, Prophase, Interphase
Interphase, Metaphase, Prophase, Telophase, Anaphase, Cytokinesis
Cytokinesis, Prophase, Metaphase, Anaphase, Telophase, Interphase
- 34. Multiple Choice
Which of the following take part during Interphase?
G1, S-phase, G2
G1, Mitosis, Cytokinesis
Mitosis, Cytokinesis, S-phase
G2, Prophase, Metaphase
- 35. Multiple Choice
Which of the following is the longest phase of the cell cycle?
Interphase
Prophase
Telophase
Cytokinesis
- Answer choicesTagsAnswer choicesTags