Have an account?
Skip to Content
Build your own quiz
Suggestions for you
30 questions
Show Answers
See Preview
- 1. Multiple Choice90% of the cell's life is spent during what stage?ProphaseAnaphaseMetaphaseInterphase
- 2. Multiple Choice
In mitosis, the two resulting cells aredifferent from the starting cell and identical to each other.different from the starting cell and different from each other.identical to the starting cell and different from each other.identical to the starting cell and identical to each other. - 3. Multiple ChoiceThe process by which the nuclear material is divided equally between two new cellsmitosiscancerspindlecentromere
- 4. Multiple ChoiceWhich is Metaphase?AECF
- 5. Multiple ChoiceThe phase in mitosis where chromosomes move away and are pulled apart by spindles to opposite sides of the cell.prophaseanaphasemetaphasetelephase
- 6. Multiple ChoiceIdentify the Cell Cycle Stage.InterphaseAnaphaseTelophaseProphase
- 7. Multiple ChoiceIdentify the Cell Cycle Stage.AnaphaseCytonkinesisInterphaseProphase
- 8. Multiple ChoiceIdentify the Cell Cycle Stage.CytokinesisInterphaseAnaphaseMetaphase
- 9. Multiple ChoiceIdentify the Cell Cycle Stage.AnaphaseCytokinesisTelophaseMetaphase
- 10. Multiple ChoiceIdentify the Cell Cycle Stage.ProphaseInterphaseAnaphaseTelophase
- 11. Multiple ChoiceNuclear membrane forms around chromosomes and begins to separate.AnaphaseTelophaseProphaseInterphase
- 12. Multiple ChoiceWhat stage is a cell in when cleavage is present in the cell division?InterphaseProphaseCytokinesisMetaphase
- 13. Multiple ChoiceDuring which state of Interphase does the cell cycle is DNA Replicated?G1G2S-phaseMitosis
- 14. Multiple ChoiceWhich sequence of DNA bases would pair with this partial strand
ATG TGA CAGATG TGA CAGTAC ACT GTCGTA AGT GACCAT TCA CTG - 15. Multiple ChoiceWhich of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil
- 16. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 17. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 18. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 19. Multiple ChoiceThe enzyme that unzips the DNA to prepare for replicationhelicasereplicasepolymerasesynthase
- 20. Multiple ChoiceWhat is the correct complimentary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC
- 21. Multiple ChoiceIn what phase of the cell cycle does DNA replication take place?G1SG2M
- 22. Multiple ChoiceWhat are the three components of a nucleotide?sugar, hydrogen, nitrogen basesugar, oxygen, nitrogen basesugar, phosphate, nitrogen basesugar, phosphate, protein
- 23. Multiple ChoiceWhich enzyme proofreads the DNA after replication to catch any mistakes?primaseproof-read-aseDNA polymerasehelicase
- 24. Multiple ChoiceA strand of DNA is composed of 40% Adenine bases. What percent of bases must be Guanine?40%20%10%80%
- 25. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 26. Multiple ChoiceInterphase contains three stages, including the G1 and G2 stages. WHich of the following occurs during these gap stages?separation of chromosomescellular growthDNA replicationviral transformation
- 27. Multiple ChoiceIf a human has 46 chromosomes in each of its body cells, how many chromosomes will be in each body cell after mitosis?2346920
- 28. Multiple ChoiceThe final stage of cellular division involves the separation of the two nuclei along with the cytoplasm into two new daughter cells. This process is known as --cytokinesisrepirationmeiosismitosis
- 29. Multiple ChoiceWhen cells divide they make two ____ cells.daughtersonMomDad
- 30. Multiple ChoiceFruit fly body cells have 8 chromosomes. After mitosis, you would expect a resulting fruit fly daughter cell to have -16 chromosomes.46 chromosomes.8 chromosomes.4 chromosomes.
- Answer choicesTagsAnswer choicesTags