Have an account?
Skip to Content
Build your own quiz
Biology
9th -
11thgrade
Honors Biology Semester 1 Final Exam Review
163 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhich of the following illustrates the correct ordering of trophic levels?decomposers-carnivores-autotrophs-herbivoresherbivores-autotrophs-carnivores-decomposersproducers-herbivores-carnivores-decomposerscarnivores-producers-omnivores
- 2. Multiple ChoiceThe transfer of energy from a lower trophic level to the next highest level is roughly1%10%100%1000%
- 3. Multiple ChoiceTrophic levels are represented bysquarescirclespyramidslines
- 4. Multiple ChoiceWhich animal is the top predator?hawklizardsnakegrass
- 5. Multiple ChoiceIn the energy pyramid here, how much of the energy in each level gets lost as heat or used by the organism for survival?80%90%10%20%
- 6. Multiple ChoiceWhich of the following is a herbivore?cricketfroghawkshrew
- 7. Multiple ChoiceHawks weigh about 1.5 kg. About how much grass must be consumed by grasshoppers to support the one hawk? (Hint: multiply by 10)1.5 kg50 kg1,500 kg5,000 kg
- 8. Multiple ChoiceWhat would happen if a decomposer is removed from the ecosystem?NothingThe ecosystem would eventually dieOnly the producers would be affectedOnly the consumers would be affected
- 9. Multiple ChoiceWhat would happen to the ecosystem if the biomass of primary consumers was higher than the biomass of producers?The primary consumers will eat all of the producers...no more organisms to convert light energy to chemical energy (glucose)The primary consumers will become the producers and perform photosynthesisThe producers will become primary consumersThis is DEFINITELY not the right answer.
- 10. Multiple ChoiceWhat is the water cycle?the 3 forms of waterthe movement of water on, above, or below the surface of the Earthwhen water meltswhen clouds form
- 11. Multiple ChoiceWhich is the opposite of condensation?runoffevaporationprecipitationtranspiration
- 12. Multiple ChoiceWhat is it called when plants give off water vapor as a waste product?condensationevaporationsublimationtranspiration
- 13. Multiple ChoiceWhat follows condensation in the water cycle?evaporation, by the sun's heatcondensation, because the air is cooledprecipitation, because the cloud is saturated, or fullrun off, because gravity pulls things down
- 14. Multiple ChoiceWhat is the role of decomposers in an Ecosystem?They recycle matter and nutrients to form fossil fuelsThey are burn and release as carbon dioxideDecomposers are responsible to turn oxygen into carbon dioxideThey recycle energy back to the sun
- 15. Multiple ChoiceWhat is happening at 1?respiration: releasing CO2decomposing CO2 in the soilphotosynthesis: absorbing CO2turning CO2 from the atmosphere into organic molecules
- 16. Multiple ChoicePhotosynthesisabsorbs CO2releases CO2
- 17. Multiple ChoiceRespirationabsorbs CO2releases CO2
- 18. Multiple ChoiceGreenhouse gases....make plants greenincrease the temperature of the earthproduce oxygendecrease the temperature of the earth
- 19. Multiple ChoiceWhat biome has the most rainfall per year?TundraTaigaTropical RainforestDeciduous Forest
- 20. Multiple ChoiceWhat biome covers half of the USA?TundraTaigaTropical RainforestDeciduous Forest
- 21. Multiple ChoiceWhat biome is the coldest?TundraTaigaTemperate ForestDesert
- 22. Multiple ChoiceWhich biome receives the least amount of precipitation?DesertGrasslandsSavannaTropical Rainforest
- 23. Multiple ChoiceIf an area has fir, spruce, and pine trees and the winters are cold, you are probably in a ________.TaigaTundraGrasslandDesert
- 24. Multiple ChoiceAbiotic factors are parts of the environment that are...NonlivingLivingPopulationsVegetation
- 25. Multiple ChoiceThe trees in this forest biome have needle like leaves that are hard to eat.Coniferous ForestDeciduous ForestTropical Rain ForestsDeserts
- 26. Multiple ChoiceWhich biome is MOST LIKE the "desert" in terms of precipitation?tropical rainforesttemperate deciduous foresttundraconiferous forest
- 27. Multiple ChoiceIdentify the Biome in the picture:tundratropical rainforestdesertgrassland
- 28. Multiple ChoiceIn which biome would you MOST LIKELY find this organism?savannatropical rainforesttemperate grasslandtundra
- 29. Multiple ChoiceThe permanently frozen soil below the arctic tundra.porafrostpermafrostperlafrostpolarfrost
- 30. Multiple ChoiceYou should always carry the microscope by thearm and basearm and body tubearm only
- 31. Multiple ChoiceThe diaphragm helps tofocusallow light to pass through the stagechange the lens size
- 32. Multiple ChoiceWhen looking at a specimen on your slide, you should always start with thelow objective lensmedium objective lenshigh objective lens
- 33. Multiple ChoiceThe _______focuses the image under low power.revolving nosepiecefine adjustment knobcoarse adjustment knob
- 34. Multiple ChoiceThe__________ sharpens the image under high magnification.revolving nosepiecefine adjustment knobcoarse adjustment knob
- 35. Multiple ChoiceWhat is number 17?body tubearmstagebase
- 36. Multiple ChoiceWhat is number 16?revolving nosepieceobjective lensebody tubeeyepiece
- 37. Multiple ChoiceWhat is number 18?stagestage clipscoarse adjustmentfine adjustment
- 38. Multiple ChoiceWhich of the following statements is not part of the cell theory?Cells are the basic unit of structure and function in all living things.All cells are produced from other cells.Only animal cells are composed of cells.All living things are composed of cells.
- 39. Multiple ChoiceWhat is one way in which all living things on Earth are alike?All living things have hair.All living things are made of cells and come from other cells.The cells of all living things have chloroplast.All living things can move.
- 40. Multiple ChoiceWhich statement reflects one of the major components of the cell theory?All living things are multi-cellular.Organs are the basic unit of structure and function for all living things.All cells come from previously existing cells.Every organism has a reproductive system to ensure survival of the species.
- 41. Multiple ChoiceWhat structures distinguish a plant cell from an animal cell?Plant cells have cell walls and ribosomes.Plant cells have cell walls and chloroplasts.Plant cells have chloroplasts and ribosomes.Plant cells have chloroplasts and mitochondria.
- 42. Multiple ChoiceWhen cells are damaged, new cells are created by cell division. How does the cell theory support this fact?It states that all cells have a nucleus which divides.It states that all living things are made up of one or more cells.It states that cells come from previously existing cells.It states that the basic units of structure and function are cells.
- 43. Multiple ChoiceThe basic unit of life is called a (n)atomcompoundcellenergy
- 44. Multiple Choice"Endosymbiosis" meansLiving togetherLiving insideEntering togetherJoining together
- 45. Multiple ChoiceThe theory of Endosymbiosis explainsThe origin of eukaryotesHow species developHow bacteria liveWhy cells rely on one another
- 46. Multiple Choice____________ & _________________ are organelles that definitely arose from endosymbiosis.Rough ER & Smooth ERMitochondria & FlagellumChloroplast & MitochondriaChloroplast and Golgi apparatus
- 47. Multiple ChoiceWhat did the host cell receive from its endosymbiont (cell living inside of it)?ShelterMotilityEnergyReproduction
- 48. Multiple ChoiceWhat did the endosymbiont (cell living inside another) receive from its host cell?ShelterEnergyMotilityReproduction
- 49. Multiple ChoiceLiving things need energy to survive?TrueFalse
- 50. Multiple ChoiceAll living things are composed of cells.TrueFalse
- 51. Multiple ChoiceLiving things do all of the following except:Respond to stimulusGrow and developmaintain homeostasisThey do not change
- 52. Multiple ChoiceLiving things respond to the environment (homeostasis) and external stimuli (react to something).TrueFalse
- 53. Multiple ChoiceDuring ___________ conditions inside our body are kept stable (the same)homeopathicHomo sapianhomeostasishomologous
- 54. Multiple ChoiceAn example of homeostasis includes maintaining :oxygen levelbody temperatureblood sugar levelall of these levels
- 55. Multiple ChoiceWhat does reproduce mean?They growThey are living thingsOrganisms make other organisms
- 56. Multiple ChoiceWhat is a living thing?reproductionorganismdevelopmenthomeostasis
- 57. Multiple ChoiceWhat type of cell is pictured?ProkaryoticEukaryoticPlantAnimal
- 58. Multiple ChoiceWhich is true of prokaryotic and eukaryotic cells?Prokaryotic cells are larger than eukaryotic cells.Eukaryotic cells do not have nuclei, and prokaryotic cells do have nuclei.Prokaryotic cells lack membrane-bound organelles, and eukaryotic cells contain membrane-bound organelles.Eukaryotic cells are simpler than prokaryotic cells.
- 59. Multiple ChoiceWhich of the following would be found in both eukaryotic AND prokaryotic cells?chloroplastcytoplasmnucleusendoplasmic reticulum
- 60. Multiple ChoiceType of cell shown?BacterialProkaryoticEukaryoticRed blood
- 61. Multiple ChoiceCells of organism must replicate for ?growthrepair of damaged cellsreplacement of dying cells.All of the above
- 62. Multiple ChoiceBefore cells can divide, what must be copied?mitochondriacytoplasmDNACell Wall
- 63. Multiple ChoiceThe division of the nucleus is known as:SynthesisMitosisG1G2
- 64. Multiple ChoiceHumans have ________ pairs of chromosomes.212346None of the above
- 65. Multiple ChoiceEukaryotic cells store their genetic information(DNA) in __________.ChromosomesCentromereskaryotypesProteins
- 66. Multiple ChoiceThe individual strands on duplicated chromosomes are called_____________CentromeresdaughtersChromatidsKaryotypes
- 67. Multiple ChoiceA pair of chromosomes that consists of XX is a __________________.MaleFemale
- 68. Multiple ChoiceThe cell spends most of it's life in ________________.mitosiscytokinesisInterphaseNone of the above
- 69. Multiple ChoiceIn the G1 stage of the cell cycle, the cellGrowsMaturesCarries on normal activitiesAll of the above
- 70. Multiple ChoiceIn the S stage of interphase_______________the cell growsthe nucleus dividesthe cell membrane dividesthe DNA is replicated
- 71. Multiple ChoiceIn the G2 stage of cell division, ______________ are made.organellesstructures for cell divisionproteinsall of the above
- 72. Multiple ChoiceA human cell has 46 chromosomes before mitotic division. How many chromosomes will the daughter cells after mitosis.12234692
- 73. Multiple ChoiceProphaseInterphaseAnaphaseTelophase
- 74. Multiple ChoiceAnaphaseCytokinesisTelophaseMetaphase
- 75. Multiple ChoiceCytokinesisInterphaseAnaphaseMetaphase
- 76. Multiple ChoiceAnaphaseCytonkinesisInterphaseProphase
- 77. Multiple ChoiceInterphaseAnaphaseTelophaseProphase
- 78. Multiple ChoiceIn mitosis, the two resulting cells aredifferent from the starting cell and identical to each other.different from the starting cell and different from each other.identical to the starting cell and different from each other.identical to the starting cell and identical to each other.
- 79. Multiple ChoiceHow many chromosomes do humans have?462110
- 80. Multiple ChoiceIf the environment gets cold, we will often shiver in order to:keep body temperature the same as the external temperaturedecrease body temperatureincrease body temperatureregulate blood pressure
- 81. Multiple ChoiceThe maintenance of an organism’s internal environment is called:compensatinghomeostasisbalancingroutine
- 82. Multiple ChoiceWhen a threatening situation appears, what is the name of the instinctive mechanism used by animals to protect themselves?Flight or RunHide and SeekFight or FlightRun and Fight
- 83. Multiple ChoiceName the levels of organization in the human body in order from smallest to largest:Tissue, organ, organ systemOrgan system, tissue, organs, cellsCells, tissue, organs, organ systemCells , organs, tissue, organ system
- 84. Multiple ChoiceWhat type of feedback loop is shown?PositiveNeutralNegative
- 85. Multiple ChoiceTrue or False Blood clotting and uterine contractions are good examples of negative feedback.TrueFalse
- 86. Multiple ChoiceWhat type of feedback loop is shown?negativeneutralpositive
- 87. Multiple ChoiceWhen you are cold, you shiver and your blood vessels contract, which warms you up. When you are hot, you sweat and your blood vessels expand, which cools you down.Positive Feedback ResponseNegative Feedback Loop
- 88. Multiple ChoiceWhich of the following is an example of positive feedback to indirectly maintain homeostasis?the chemical reactions involved in blood clottingyour blood vessels dilate and you begin to sweat in response to elevated body temperatureyour blood vessels constrict and you begin to shiver in response to low body temperatureyour coach compliments you on your performance in practice
- 89. Multiple ChoiceOsmosis is the movement of _____ across a membrane.foodenergyoxygenwater
- 90. Multiple ChoiceWhich is true about active transport?It requires energyit does not require energyIt moves substances down the concentration gradientit moves material from high to low concentration
- 91. Multiple ChoiceThis picture represents which type of cellular transport?passive transportendocytosisexocytosisosmosis
- 92. Multiple ChoiceThe cell below is in a _________ solution.HypotonicHypertonicIsotonic
- 93. Multiple ChoiceThis cellular structure helps organisms maintain homeostasis by controlling what substances may enter or leave cells.vacuolenucleuscell membranecell wall
- 94. Multiple ChoiceThe cell below is in a _____________ solution.HypertonicHypotonicIsotonic
- 95. Multiple ChoiceA cell in a hypotonic solution willswellshrinkstay the same sizeimpossible to tell
- 96. Multiple ChoiceA cell in an isotonic solution willswellshrinkstay the same sizeimpossible to tell
- 97. Multiple ChoiceA saltwater fish is accidentally placed in a freshwater aquarium in a few short hours it sadly died. Which explains why this occurred?The cells of the fish body were dehydrated by the quick loss of water.The cells of the fish quickly absorbed massive amounts of water and it ended up killing the fish.The fish hated the new decor in the freshwater tank.It was just its time.
- 98. Multiple ChoiceWhich term means "water-loving"?CohesionNonpolarHydrophilicHydrophobic
- 99. Multiple ChoiceWhich term means "water-fearing"?AdhesionPolarHydrophilicHydrophobic
- 100. Multiple ChoiceThe cell membrane is made mostly ofphospholipid monolayer and proteinsphospholipid bilayer and proteinsproteins and carbohydrates bilayertriglycerides and carbohydrates
- 101. Multiple ChoiceWhat type of transport is this?facilitated diffusionactive transportdiffusionosmosis
- 102. Multiple ChoiceWhich organelle does photosynthesis take place in?MitochondrionChlorplastCytoplasmNucleus
- 103. Multiple ChoiceWhat are the reactants of photosynthesisWater, light, and carbon dioxidesugar, light and waterWater, light, carbon dioxidesugar and oxygen
- 104. Multiple ChoiceWhat are the products of photosynthesis?Sunlight and wateroxygen and sugarEnergy and Carbon dioxideHeat
- 105. Multiple ChoiceThe sac like portion inside the chloroplast is calledGolgi appartusEndoplasmic reticulumStromaThykloids
- 106. Multiple ChoiceThe fluid like substance found inside the chloroplast is calledCytoplasmStromaThykloidsCell Wall
- 107. Multiple ChoiceWhich of the following is the correct equation for PHOTOSYNTHESIS?6CO2 + 6H2O --> 6O2 + C6H12O66CO2 + C6H12O6 + 6H2O --> O26O2 + 6H2O --> 6CO2 + C6H12O6C6H12O6 + 6O2 ---> 6H2O + 6CO2
- 108. Multiple ChoiceWhat pigment absorbs sunlight for photosynthesis?chloroplastthylakoidgranachlorophyll
- 109. Multiple ChoiceThe main source of energy for all life comes from ____.the Earththe moonthe sunthe food we eat/make
- 110. Multiple ChoiceHow can photosynthesis be related to cellular respiration?What's produced (made) by one is needed (the reactants) for the otherThey both produce the same productsThey both have the same reactants (need the same things)These 2 processes have nothing in common
- 111. Multiple ChoiceAll living things do which of the following?ChemosynthesisRespirationphotosynthesisall of the answers
- 112. Multiple ChoiceWhat is one of the reactants of cellular respiration?energyglucosecarbon dioxidewater
- 113. Multiple Choice______________ produces the most ATP.photosnthesisaerobic respirationanaerobic respirationglycolysis
- 114. Multiple ChoiceWhat is the molecule called that mitochondria produce when they respire glucose?ATPADPDNA80p
- 115. Multiple ChoiceHow many ATP are gained through glycolysis?02430-38
- 116. Multiple ChoiceWhere does glycolysis occur?Inner mitochondrial membraneMitochondrial MatrixCytosolAt a ribosome
- 117. Multiple ChoiceWhere does ETC occur?Mitochondrial matrixOuter mitochondrial membraneInner mitochondrial membraneCytosol
- 118. Multiple Choicewhat travel through the electron transport chain?cellselectronsbloodthylokoid
- 119. Multiple Choiceat the end, ____ turns into ____NADPH, NADPATP, ADPADP, ATPNADP, NADPH
- 120. Multiple Choicehow many ATP can be produce from 1 glucose?240438
- 121. Multiple ChoiceATP is formed from photosynthesis and cellular respirationtruefalse
- 122. Multiple Choicewhat is ATP?newly used word for ADPpart of a membraneenergy carrier
- 123. Multiple ChoiceLactic acid fermentation occurs in your muscles after a workout because your cells are struggling to get...GlucoseSunlightOxygenWater
- 124. Multiple ChoiceBecause fermentation takes place in the absence of oxygen, it is said to beaerobicanaerobiccyclicoxygen-rich
- 125. Multiple ChoiceThe process carried out by yeast that causes bread to rise isalcoholic fermentationlactic acid fermentationcellular respirationyeast mitosis
- 126. Multiple ChoiceWhat part of our cells holds our DNA?cytoplasmcell membranenucleusribosomes
- 127. Multiple ChoiceWhat has DNA?animalsplantsbacteriaall of the above
- 128. Multiple ChoiceWhich of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil
- 129. Multiple ChoiceWhich of the following units are repeatedly joined together to form a strand of DNA?amino acidsnucleotidesfatty acidspolysaccharides
- 130. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 131. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 132. Multiple ChoiceWhat are the 4 nitrogen bases?adenine, thymine, cytoplasm, and guanineadenine, thymine cytosine, and guanineadenine, thymine, cytosine, and gylceroladenine, thymine, cytosine, and glucose
- 133. Multiple ChoiceWhat is the relationship between a protein, the cell, and DNA?DNA is produced by protein which is produced in the cellProtein is composed of DNA which is produced in the cellDNA controls the production of protein in the cellA cell is composed of DNA and protein
- 134. Multiple ChoiceWhere does Translation take place?RNAribosomenucleuschromosome
- 135. Multiple ChoiceSpecific proteins produced in a cell are directly related to thenumber of mitochondria in the celltypes of ribosomes in the cellsequence of sugars and phosphates in the cellsequence of nucleotides in the DNA
- 136. Multiple ChoiceThe process of making RNA (i.e. mRNA) from DNA is calledReplicationTranscriptionTranslationProtein synthesis
- 137. Multiple ChoiceWhich shows the correct complementary base pairing for DNA?C-A, T-GA-G, C-TC-G, U-AT-A, G-C
- 138. Multiple ChoiceA segment of DNA that codes for a protein is called a...EnzymeMutationGeneComplimentary
- 139. Multiple ChoiceWhich of the following displays the correct order of DNA replication?
1. Sugar and phosphate groups form the side of each new strand
2. DNA unzips
3. The bases attach from a supply in the cytoplasm
4. DNA unwinds4-2-3-12-4-1-32-4-3-14-2-1-3 - 140. Multiple ChoiceWhat is the term for a three nucleotide sequence that codes for an amino acid? For example: AUGNitrogen baseCodonAminePhosphate group
- 141. Multiple ChoiceTransfer RNA (tRNA) is important because it __________.Carries amino acids to the ribosomeCarries ribosomes to the ERCarries glucose to mitochondriaCarries mRNA out of the nucleus
- 142. Multiple ChoiceIf the percentage of DNA is made of 30% Thymine, what is the correct percentage of Guanine?30152060
- 143. Multiple ChoiceThe enzyme that unzips the DNA to prepare for replicationhelicasereplicasepolymerasesynthase
- 144. Multiple ChoiceA scientist observes a base sequence of AGCTAGCTAGCT. Which of the following would be the complimentary strand?TGCATGCATGCATCGATCGATCGATAGCTAGCTAGCTTAAGGCCTTCC
- 145. Multiple ChoiceThe bonds that hold the two strands of DNA together come from...the attraction of phosphate groupsstrong bonds between bases and sugarscarbon to carbon bonds in the sugarweak hydrogen bonds between the bases
- 146. Multiple ChoiceThe DNA nucleotide is composed of three parts. Which two components make up the nucleotide backbone?ribose sugar and baseribose sugar and phosphate groupnitrogen base and deoxyribose sugardeoxyribose sugar and phosphate group
- 147. Multiple ChoiceThis enzyme joins Okazaki fragments together.PolymeraseLigaseTelomeraseHelicase
- 148. Multiple ChoiceDNA is built in the3'-3' direction5'-5' direction3'-5' direction5'-3' direction
- 149. Multiple ChoiceThe ___________________ strand builds continuously.LaggingLigaseLeadingTelomeres
- 150. Multiple ChoiceWhen does replication occur?G0 phaseG1 phaseG2 phaseS phase
- 151. Multiple ChoiceWhat mutation has occurred here?
T-G-A-C-C-A
T-G-A-G-C-ASubstitutionDeletionInsertionFrameshift - 152. Multiple ChoiceAre all mutations bad?YesNo
- 153. Multiple ChoiceATTTGAGCC- Original
ATTGAGCC - Mutated
The example above is an example of aInsertion- FrameshiftDeletion- SubstitutionDeletion -FrameshiftAll of the above - 154. Multiple ChoiceIdentify the SUBSTITUTION mutation from the following:
ATG CCA AATATG TCA AATATG CCT AAA TATC CA ATATG CCA AAT - 155. Multiple ChoiceIdentify the DELETION mutation form the following:
ATG CCA AATATG TCA AATATG CCT AAA TATC CA ATATG CCA AAT - 156. Multiple ChoiceIdentify the ADDITION mutation form the following:
ATG CCA AATATG TCA AATATG CCT AAA TATC CA ATATG CCA AAT - 157. Multiple ChoiceWhich RNA bases would pair with TACGAA in transcription?AUGCUUATGCTTGCATCCGCAUCC
- 158. Multiple ChoiceIn DNA replication, which enzyme is responsible for building the new DNA strand?helicasepolymeraseligaseprimase
- 159. Multiple ChoiceWhat is occurring in this picture?TranslationReplicationTranslocationTranscription
- 160. Multiple ChoiceWhat would be the tRNA anticodon for the mRNA codon CAG?GTCGUCCUGCAG
- 161. Multiple ChoiceWhat type of bonds are forming during translation?Peptide bondsHydrogen bondsAcid bonds
- 162. Multiple ChoiceHow many amino acids are coded for by this sequence of nucleotides:
ATG GGA ACT CCA42612 - 163. Multiple ChoiceWhat is the correct amino acid sequence for the mRNA code AUGCCAGUAUGAMet-Pro-Ala-ValMet-Pro-ValTyr-Gly-HisTyr-Gly-Arg-His
- Answer choicesTagsAnswer choicesTags