Have an account?
Skip to Content
Build your own quiz
40 questions
Show Answers
See Preview
- 1. Multiple Choice
Which of the following best describes a DNA molecule?double helixcontains ribosemade of amino acidscontains Uracil - 2. Multiple ChoiceWhich of the following units are repeatedly joined together to form a strand of DNA?amino acidsnucleotidesfatty acidspolysaccharides
- 3. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 4. Multiple ChoiceAdenine bonds with ______________.GuanineThymineCytosineAdenine
- 5. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 6. Multiple ChoiceWhich sequence of DNA bases would pair with this partial strand
ATG TGA CAGATG TGA CAGTAC ACT GTCGTA AGT GACCAT TCA CTG - 7. Multiple ChoiceWhat determines the code, or information, of a DNA molecule?the shape (structure) of the nitrogen basesthe order (sequence) of the nitrogen basesthe color of the nitrogen basesthe frequency (number) of nitrogen bases
- 8. Multiple ChoiceWhich 2 molecules form the sides (backbone) of the DNA ladder?deoxyribose sugar and adeninedeoxyribose sugar and a hydrogen bonddeoxyribose sugar and the nucleusdeoxyribose sugar and phosphate
- 9. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuolechloroplastnucleus
- 10. Multiple ChoiceNitrogenous bases are joined by which type of bond?polar bondsionic bondscovalent bondshydrogen bonds
- 11. Multiple ChoiceReplicate the following strand of DNA:
AATCATGGAAATCATGGATTAGTACCTUUAGUACCUGGATAUCUA - 12. Multiple ChoiceThe enzyme that unzips the DNA to prepare for replicationhelicasereplicasepolymerasesynthase
- 13. Multiple ChoiceDNA replication results in two DNA molecules,each one with two original strandseach one with two new strandseach one with one new strand and one original strandone with two new strands and the other with two original strands
- 14. Multiple Choiceorder of replication3, 2, 1, 42, 1, 4, 32, 3, 1, 43, 4, 1, 2
- 15. Multiple ChoiceA process in which DNA has the unique ability to make an exact copy of itself.ReplicationTranslationTranscription
- 16. Multiple ChoiceWhat is the correct complimentary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC
- 17. Multiple ChoiceThe drawing shows the structure of what molecule?A DNA moleculeA lipid moleculeA carbohydrate moleculeA protein molecule
- 18. Multiple ChoiceIn what phase of the cell cycle does DNA replication take place?G1SG2M
- 19. Multiple ChoiceWhat are the three components of a nucleotide?sugar, hydrogen, nitrogen basesugar, oxygen, nitrogen basesugar, lipid, protiensugar, phosphate, protein
- 20. Multiple ChoiceWhich of the following things is NOT part of a nucleotide?a sugara nitrogen basea phosphatea polymerase
- 21. Multiple ChoiceChargraff's Rule says thatAdenine will be equal to ThymineCytosine will be equal to ThymineUracil will be equal to GuanineAdenine will be equal to Cytosine
- 22. Multiple ChoiceDNA is copied duringTranslationTranscriptionReproductionReplication
- 23. Multiple ChoiceThe enzyme that unzips the DNA to prepare for replicationhelicasereplicasepolymerasesynthase
- 24. Multiple ChoiceThe principle Chargaff created that said adenine pairs with thymine and guanine pairs with cytosine is calledbase pairing rulesuper coiling rulereplication rulesubstitution rule
- 25. Multiple ChoiceWhat does DNA stand for?Ribonucleic AcidDeoxyribonucleic AcidBoth of theseNone of these
- 26. Multiple ChoiceIn what part of the cell cycle is DNA replicating in preparation for division?ProphaseMetaphaseInterphaseTelophase
- 27. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 28. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 29. Multiple ChoiceAdenine bonds with ______________.GuanineThymineCytosineAdenine
- 30. Multiple ChoiceWhat is the structure of DNA?A single helixNitrogen basesA double helixIt has no structure
- 31. Multiple ChoiceIn a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil
- 32. Multiple ChoiceWhat sugar is in DNA?deoxyriboseriboseoxyribosedeoxyose
- 33. Multiple ChoiceThe backbone of a DNA molecule is made of which two components?phosphate molecules and ribose sugarsdeoxyphosphate molecules and ribose sugarsphosphate molecules and deoxyribose sugarsdeoxyphosphate molecules and deoxyribose sugars
- 34. Multiple ChoiceThe enzyme that attaches free nucleotides to the newly unzipped old strands is calledDNA PolymeraseLactaseDNA AcitasePolyatomic Ligase
- 35. Multiple ChoiceIf the percentage of DNA is made of 30% Thymine, what is the correct percentage of Guanine?30152060
- 36. Multiple ChoiceWhat is responsible for holding the two strands of the DNA double helix together?hydrogen bondsallelesLondon dispersion forcesdeoxyribose sugars
- 37. Multiple ChoiceWhich component of DNA specifies the traits of an organism?5-carbon sugar (deoxyribose)hydrogen bondsphosphate groupsnitrogenous base pairs
- 38. Multiple ChoiceThe nucleic acid DNA is composed ofsugar, protein, and nitrogenous bases.protein, nitrogenous bases, and phosphate.nitrogenous bases, phosphate, and RNA.sugar, phosphate, and nitrogenous bases.
- 39. Multiple ChoiceName this structuredouble helixnucelotidetwisted ladderhydrogen bond
- 40. Multiple ChoiceMistakes in DNA copying are avoided by...Making completely new copies of DNAUsing semiconservative replicationOnly keeping old DNACopying DNA extremely slowly
- Answer choicesTagsAnswer choicesTags