Have an account?
Skip to Content
Build your own quiz
18 questions
Show Answers
See Preview
- 1. Multiple ChoiceIf the percentage of DNA is made of 30% Thymine, what is the correct percentage of Guanine?30152060
- 2. Multiple Choice
Replicate the following strand of DNA:
AATCATGGAAATCATGGATTAGTACCTUUAGUACCUGGATAUCUA - 3. Multiple ChoiceThe enzyme that unzips the DNA to prepare for replicationhelicasereplicasepolymerasesynthase
- 4. Multiple ChoiceDNA replication results in two DNA molecules,each one with two original strandseach one with two new strandseach one with one new strand and one original strandone with two new strands and the other with two original strands
- 5. Multiple ChoiceA scientist observes a base sequence of AGCTAGCTAGCT. Which of the following would be the complimentary strand?TGCATGCATGCATCGATCGATCGATAGCTAGCTAGCTTAAGGCCTTCC
- 6. Multiple ChoiceA process in which DNA has the unique ability to make an exact copy of itself.ReplicationTranslationTranscription
- 7. Multiple ChoiceThe bonds that hold the two strands of DNA together come from...the attraction of phosphate groupsstrong bonds between bases and sugarscarbon to carbon bonds in the sugarweak hydrogen bonds between the bases
- 8. Multiple ChoiceThe DNA nucleotide is composed of three parts. Which two components make up the nucleotide backbone?ribose sugar and baseribose sugar and phosphate groupnitrogen base and deoxyribose sugardeoxyribose sugar and phosphate group
- 9. Multiple ChoiceWhat is responsible for holding the two strands of the DNA double helix together?hydrogen bondsallelesLondon dispersion forcesdeoxyribose sugars
- 10. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 11. Multiple ChoiceWhat are the 4 nitrogen bases?adenine, thymine, cytoplasm, and guanineadenine, thymine cytosine, and guanineadenine, thymine, cytosine, and gylceroladenine, thymine, cytosine, and glucose
- 12. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuolechloroplastnucleus
- 13. Multiple ChoiceDescribes the twisted ladder-like shape of a DNA moleculeNitrogen BaseHexagonDouble Helix
- 14. Multiple ChoiceWhich component of DNA specifies the traits of an organism?5-carbon sugar (deoxyribose)hydrogen bondsphosphate groupsnitrogenous base pairs
- 15. Multiple ChoiceWhat term names the process during which DNA is copied prior to cell division?DNA polymeraseDNA replicationDNA regnerationDNA redistribution
- 16. Multiple ChoiceAfter analyzing a sample of DNA, a scientist recorded the data shown in the table. What percentage of the DNA sample is cytosine?22%25%28%56%
- 17. Multiple ChoiceThe nucleic acid DNA is composed ofsugar, protein, and nitrogenous bases.protein, nitrogenous bases, and phosphate.nitrogenous bases, phosphate, and RNA.sugar, phosphate, and nitrogenous bases.
- 18. Multiple ChoiceName this structuredouble helixnucelotidetwisted ladderhydrogen bond
- Answer choicesTagsAnswer choicesTags