Have an account?
Skip to Content
Build your own quiz
Suggestions for you
40 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhat is the name for when DNA makes another copy of itself?transcriptiontranslationreplicationduplication
- 2. Multiple ChoiceWhat is the name for when the RNA info is read and turned into a protein?transcriptiontranscribationtranslationreplication
- 3. Multiple ChoiceIn translation, the language of the bases is turned into the language of ___.proteinsamino acidsnucleic acidsnucleotides
- 4. Multiple ChoiceWhere does transcription take place?nucleuscytoplasmrough ERmitochondrion
- 5. Multiple ChoiceWhere does translation take place?nucleussmooth ERlysosomecytoplasm
- 6. Multiple ChoiceWhat is the name for this RNA --> proteins?translationtranscriptionreplicationnone of these
- 7. Multiple ChoiceThe genetic code is read three "letters" at a time, so that each "word" is three bases long and corresponds to a single amino acid. What is each three-letter "word" in mRNA know as?an anitcodona codona decoding banda gene
- 8. Multiple Choice
Nucleotides are made up of a sugar, phosphate, and..?nitrogenous basenucleic acidcholesterolfatty acid - 9. Multiple ChoiceDNA codes for...cholesterolproteinsfatty acidscarbohydrates
- 10. Multiple ChoiceWhich sequence of DNA bases would pair with this partial strand
ATG TGA CAGATG TGA CAGTAC ACT GTCGTA AGT GACCAT TCA CTG - 11. Multiple ChoiceLooking at the mRNA strand, how many codons are there.
UCGAGACU8421 - 12. Multiple ChoiceA long strand of RNA nucleotides that are formed complementary to one strand of DNA. They also travel from the nucleus to the ribosome to direct the making of a specific protein.tRNArRNADNAmRNA
- 13. Multiple ChoiceThe _______ represents the shape of the dna molecule.HelixDouble HelixLadderQuartenary
- 14. Multiple ChoiceWhat does RNA contain that DNA does not?ThymineUracilAdenineLove
- 15. Multiple ChoiceWhat is the correct DNA complementary base to
AAT CGT TACAAT GCA TACTTA CGT ATGTTA GCA ATGUUA GCA AUG - 16. Multiple ChoiceWhich is a difference between DNA and RNARNA is double strandedRNA is not made of nucleotidesRNA contains Uracil instead of ThymineRNA does not contain a sugar
- 17. Multiple ChoiceGenetic info flows in one direction. Which best represents this flow?DNA-protein-RNAProtein-RNA-DNARNA-protein-DNADNA-RNA-protein
- 18. Multiple ChoiceHow many parts make up a Nucleotide?OneTwoThreeFour
- 19. Multiple ChoiceWhat base does Cytosine pair with?GuanineThymineAdenineRibose
- 20. Multiple ChoiceWhat base does Adenine pair with?GuanineCytosineThymineDeoxyribose
- 21. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuolechloroplastnucleus
- 22. Multiple ChoiceWhere does protein synthesis takes place?vacuoleribosomechloroplastmitochondria
- 23. Multiple ChoiceA codon consists of how many nucleotides1234
- 24. Multiple ChoiceWhat amino acid is represented by the codon UUA?PhenylalanineTyrosineLeucineStop codon
- 25. Multiple ChoiceWhat amino acid is represented by the codon CAG?Aspartic AcidHistidineGlutamineMethionine
- 26. Multiple ChoiceWhat is the correct amino acid sequence for the mRNA code AUGCCAGUAUGAMet-Pro-Ala-ValMet-Pro-ValTyr-Gly-HisTyr-Gly-Arg-His
- 27. Multiple ChoiceWhich is the mRNA molecule that would be transcribed from this DNA template:
TGGCAAGTACGTACCGTTCATGCAUGGCAAGUACGUUCCGUUCUUGCUACCGUUCAUGCA - 28. Multiple ChoiceWhat amino acid is represented by the codon UUU?PhenylalanineTyrosineLeucineStop codon
- 29. Multiple ChoiceWhat amino acid is represented by the codon CAU?Aspartic AcidHistidineGlutamineMethionine
- 30. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code CCC?GlyLysAlaPro
- 31. Multiple ChoiceWhich amino acid would be synthesized given the DNA sequence GTA?HistidineValineThreonineMethionine
- 32. Multiple ChoiceThis diagram can be used to specify amino acid sequences in polypeptides. Which sequence of the genetic code would produce a polypeptide with the amino acid sequence Ala-Arg-Pro?GCAAGACCUGACCUGCUCGCCAGUCCGACGGCGUCC
- 33. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code GCA?GlyLysAlaPro
- 34. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code GGA?GlyLysAlaPro
- 35. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code UUC?GlyLysAlaPhe
- 36. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code AUG?GlyLysAlaMET
- 37. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code UAA?StopLysAlaPro
- 38. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code UCA?SerLysAlaPro
- 39. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code GUA?GlyLysAlaVal
- 40. Multiple ChoiceIn the chart, which amino acid is specified by the mRNA code ACA?GlyLysAlaThr
- Answer choicesTagsAnswer choicesTags