Have an account?
Skip to Content
Build your own quiz
35 questions
Show Answers
See Preview
- 1. Multiple ChoiceWhich of the following units are repeatedly joined together to form a strand of DNA?amino acidsnucleotidesfatty acidspolysaccharides
- 2. Multiple Choice
In a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount ofcytosineguaninethymineuracil - 3. Multiple ChoiceGuanine bonds with ______________.AdenineGuanineCytosineThymine
- 4. Multiple ChoiceWhy is DNA important?it is very small and very complicatedit's in everythingit serves as the blueprint for traits of all living thingsbecause we eat it every day for energy
- 5. Multiple ChoiceWhat are the 4 nitrogen bases?adenine, thymine, cytoplasm, and guanineadenine, thymine cytosine, and guanineadenine, thymine, cytosine, and gylceroladenine, thymine, cytosine, and glucose
- 6. Multiple ChoiceWhat determines the code, or information, of a DNA molecule?the shape (structure) of the nitrogen basesthe order (sequence) of the nitrogen basesthe color of the nitrogen basesthe frequency (number) of nitrogen bases
- 7. Multiple ChoiceWhich 2 molecules form the sides (backbone) of the DNA ladder?deoxyribose and adeninedeoxyribose and a hydrogen bonddeoxyribose and the nucleusdeoxyribose and phosphate
- 8. Multiple ChoiceWhich organelle is DNA usually found in?cell membranevacuolechloroplastnucleus
- 9. Multiple ChoiceName this structuredouble helixnucelotidetwisted ladderhydrogen bond
- 10. Multiple ChoiceDNA codes for...cholesterolproteinsfatty acidsa sandwich
- 11. Multiple ChoiceNitrogenous bases are joined by which type of bond?polar bondsionic bondscovalent bondshydrogen bonds
- 12. Multiple ChoiceNucleotides are made up of a sugar, phosphate, and..?nitrogenous basenucleic acidcholesterolfatty acid
- 13. Multiple ChoiceWhich one of the following nucleotide pair bonds would be found in a DNA molecule?adenine-guanineguanine-cytosineadenine-cytosinecytosine-uracil
- 14. Multiple ChoiceWatson and Crick were the first to suggest that DNA is _____a short moleculethe shape of a double helixa protein moleculethe genetic material
- 15. Multiple ChoiceThe pairing of _____ in DNA is the key feature that allows DNA to be copied.nucleotidesnitrogen baseschromosomescodons
- 16. Multiple ChoiceThe process by which a DNA molecule is copied is called _____.binary fissionmitosisreplicationtranslation
- 17. Multiple ChoiceA DNA nucleotide may be made up of a phosphate group, along with _____.deoxyribose sugar and uracilribose sugar and adeninedeoxyribose sugar and thymineribose sugar and cytosine
- 18. Multiple ChoiceWhich series is arranged in order from largest to smallest in size?chromosome, nucleus, cell, DNA, nucleotidecell, nucleus, chromosome, DNA, nucleotidenucleotide, chromosome, cell, DNA, nucleuscell, nucleotide, nucleus, DNA, chromosome
- 19. Multiple ChoiceWhich sequence of DNA bases would pair with this partiaal strand
ATG TGA CAGATG TGA CAGTAC ACT GTCGTA AGT GACCAT TCA CTG - 20. Multiple ChoiceA five-carbon sugar found in DNA.riboseguaninedeoxyribosehelicase
- 21. Multiple ChoiceWhere does DNA replication take place?NucleusRibosomeCytoplasmGolgi Body
- 22. Multiple ChoiceBefore the cell divides, what process needs to happen?TranscriptionTranslationReplicationProtein synthesis
- 23. Multiple ChoiceIn DNA which is a correct base pairing?A with GG with TA with UA with T
- 24. Multiple ChoiceDuring which stage of the cell cycle does chromosome replication occur?InterphaseProphaseMetaphaseAnaphase
- 25. Multiple ChoiceA single-base mutation in a DNA sequence that is GTCATA would be...GTCTTAGGTTCCAATTAAGTCCCTATACTG
- 26. Multiple ChoiceThe DNA of a prokaryotic cell is in thecytoplasmnucleuslysosomeribosome
- 27. Multiple ChoiceWhat is the correct complimentary strand for the following DNA?ATCGAGTACGAGATCGAGTAGCTGTAGCTC
- 28. Multiple ChoiceWhich of the following things does a nucleotide NOT contain?a sugara nitrogen basea phosphatea polymerase
- 29. Multiple ChoiceThe DNA is found in the nucleus of what type of organisms?BacteriaEukaryotesProkaryotesViruses
- 30. Multiple ChoiceWhich of the following is a base that is NOT contained in DNA?AdenineThymineUracilGuanine
- 31. Multiple ChoiceDNA replication results in two DNA molecules,each one with two original strandseach one with two new strandseach one with one new strand and one original strandone with two new strands and the other with two original strands
- 32. Multiple ChoiceA monomer of DNA is called a(n)MonosaccharideAmino AcidTriglycerideNucleotide
- 33. Multiple ChoiceReplicate the following strand of DNA:
AATCATGGAAATCATGGATTAGTACCTUUAGUACCUGGATAUCUA - 34. Multiple ChoiceA scientist observes a base sequence of AGCTAGCTAGCT. Which of the following would be the complimentary strand?TGCATGCATGCATCGATCGATCGATAGCTAGCTAGCTTAAGGCCTTCC
- 35. Multiple Choiceorder of replication3, 2, 1, 42, 1, 4, 32, 3, 1, 43, 4, 1, 2
- Answer choicesTagsAnswer choicesTags